Hypertrophic cardiomyopathy (HCM) is the most common form of inherited heart disease with a predominantly autosomal dominant type of inheritance. However, all genes that may be associated with the pathogenesis of HCMP have not yet been identified. In this regard, the aim of this work was to search for new genetic factors associated with the development of HCM in the Russian population.

The paper presents the results of sequencing of five genes associated with hypertrophic cardiomyopathy, using monomolecular sequencing (Oxford Nanopore Technologies). As a result of data analysis with various algorithms, missense variants were identified in the studied genes that may be the cause of the disease in the patients.

Primary cardiomyopathies (CM) are progressive myocardial disorders characterized by variable symptoms and risk of sudden cardiac death. Combination of signs of different CM types are often diagnosed during clinical survey. Clinical and genetic examinations were performed for 186 patients; in 9 (4.8%) probands the diagnostic criteria of two different types of CM were fulfilled. Potentially pathogenic genetic variants associated with both CM types were found in desmosomal and sarcomeric genes in 4 of 9 our probands.

Dilated cardiomyopathy is a serious progressive myocardial disease with a wide polymorphism of genetic causes and clinical manifestations. Mutations in the TNNT2 gene are responsible for 6% of cases of the diagnosed familial DCM. We studied the mutation spectrum in the TNNT2 gene in 92 unrelated probands with primary DCM. It was found that all clinically significant findings are concentrated at position 173 of the T-troponin protein, thus clinical polymorphism observed between variant carriers is due to various complementary factors of both hereditary and non-hereditary origin.

In the present study we report on a new case of severe early-onset dilated cardiomyopathy (DCM). In family medical history, both DCM phenotypes of different expressivity and congenital structural heart defects (CHDs) were revealed. Using high-throughput sequencing technology, we analyzed a full spectrum of genetic variants in the proband`s exome. On the results of whole-exome sequencing, we identified a novel likely-pathogenic missense variant in MYH7 encoding beta heavy chain of cardiac myosin (exon 27, c.G3578T, p.R1193L). Additionally, the proband possessed a novel missense variant of uncertain clinical significance in TBX5 (exon 7, c.T988A, p.C330S, ENST00000526441). The data obtained suggest that combination of two genetic variants in cardiac genes could cause the deterioration of the DCM clinical phenotype.

Two cases of arrhythmogenic right ventricular cardiomyopathy (ARVC) with the left ventricle involvement and skin manifestations in unrelated patients are presented in the article. In both cases, new variants in the conserved positions of the integrin-linked kinase gene (ILK), p.T181A and p.I188T, were found using the NGS method. Changes of ILK functioning disrupt cell contact with the matrix and signalling, causing cardiomyopathies development in the heart; blistering and hyperplasia of the epidermis. With a high probability, the substitutions p.T181A and p.I188T result in the ARVC and nonspecific skin manifestations in the patients described in the article. However additional investigations are required.

We searched for mutations in the KCNQ1, KCNH2 and SCN5A genes using mass parallel sequencing (MPS) in 10 patients from 8 families with a diagnosis of “long QT syndrome” (LQTS). For sample preparation, we used the targeted enrichment of DNA regions method related to the studied genes. As a result of the work, 8 mutations were revealed: 5 of them are located in the KCNQ1 gene, 2 mutations in the KCNH2 gene, 1 mutation in the SCN5A gene. In all cases, we found unique mutations that did not recur in unrelated patients. The results of this work indicate the effectiveness of using targeted panels to search for genetic abnormalities in LQTS.

Mutation detection in the coding sequences of genes associated with inherited arrhythmias was performed by next generation sequencing (NGS) in patients with Brugada syndrome. Half of the mutations are located in the genes encoding the sodium and potassium ion channel proteins (SCN5A, KCNJ2, KCNJ8, HCN4, KCNQ1). In the genes associated predominantly with other canalopathies and arrhythmogenic cardiomyopathies the mutations were found.

A left ventricular non-compaction cardiomyopathy (LVNC) is characterized by the development of a number of complications, which in combination with concomitant diseases usually leads to polypharmacy. Pharmacogenetic testing (PGT), aimed at identifying variants of genes associated with the metabolism of drugs, allows to choose the most effective and safe drug therapy in each case. The study includes 16 patients with LVNC, its complications and other diseases. All patients were assessed for 60 single nucleotide polymorphisms (SNPs) using real-time polymerase chain reaction in a QuantStudio 12KFlexReal-TimePCRSystem thermocycler (ThermoFisher Scientific, USA). According to the results of PGT 62.5% of the patients with LVNC and genotypes associated with a change in the metabolism of drugs were revealed. 12.5% of the patients had a history of taking drugs that required dose adjustment or replacement with another drug, taking into account the results of PGT.

The analysis of last 10 years work experience of medical genetics laboratory has shown the need for the development of new branches of genetics for the formation of personalized medicine in Russia. The improvement of the medical genetic services at the multidisciplinary surgical center provides great advantages in the development of family examinations.

We studied mitochondrial DNA polymorphism and mtDNA copy number in sudden cardiac death (SCD). In the SCD group, a lower mtDNA copy number was found in the myocardium. Analysis of mtDNA polymorphism revealed a higher frequency of H1 haplogroup in the SCD samples, compared with the population, as well as higher frequency of missense variant Ala177Thr in ATP6 gene in the group of cardiac arrest survivors. The results of the study suggest association of mtDNA polymorphism and mtDNA copy number with the risk of sudden cardiac death.

The aim of the study is to confirm the association with sudden cardiac death of single-nucleotide polymorphisms rs77270326, rs34643859, identified during own whole-exome sequencing as possible molecular genetic markers of sudden cardiac death. In the group of sudden cardiac death (n = 400, the average age of the dead - 53.2 ± 8.7 years, the proportion of men - 70.9%, women - 29.1%) and the control group (n = 400, average age - 53 , 1 ± 8.3 years, men - 68.3%, women - 31.7%) genotyping of the selected polymorphisms was conducted by PCR-RFLP method according to the authors’ protocols. According to the frequencies of genotypes and alleles of rs77270326 polymorphism, no statistically significant differences were found between the groups (p>0.05). A group of women under the age of 50 revealed a statistically significant decrease in the proportion of carriers of the TT genotype in the group of sudden cardiac death (32.3%) compared with the control group (60.0%) (OR = 0.32, 95% CI 0, 11-0.91, p = 0.04). Thus, the rs77270326 is not associated with sudden cardiac death. For women under the age of 50, the TT genotype of rs34643859 polymorphism is associated with a protective effect against sudden cardiac death.

Objective: Search for causal mutations in candidate genes for sudden cardiac death (SCD) in men who die before the age of 45. Materials and methods. The SCD group (30 samples) was formed using the criteria for sudden cardiac death of the WHO and the European Society of Cardiology. The average age is 31,3±5,3 years. Genomic DNA was isolated from myocardial tissue using phenol-chloroform extraction. Clinical exome sequencing was performed. At the first stage, the results of sequencing of 16 genes were analyzed, mutations in which result in CVD associated with an increased risk of SCD: KCNQ1, KCNH2, SCN5A, AKAP9, ANK2, CACNA1C, CALM1, CALM2, CAV3, KCNE1, KCNE2, KCNJ5, KCNJ5, SNTA1, SCN10A. Results. Of 30 samples with SCD, when analyzing the results of sequencing 16 genes, 6 probably pathogenic missense mutations were found in 7 samples (23.3%). 2 mutations were found in the SCN10A gene, one mutation in KCNH2, KCNE1, AKAP9, SNTA1. Findings. Summing up the first results of a pilot SCD study, the following preliminary conclusions can be drawn: it is necessary to continue research in the field of molecular autopsy in Russia, in order to increase the effectiveness of the search for causative mutations, it is desirable to reduce the age of SCD cases included in the study, as well as work with families of deceased SCD.

This report describes a clinical case of homozygous hypercholesterolemia. A patient with signs of connective dysplasia (elbow and knee joints hyperextension), presences xanthomatosis of on the elbows of both hands and on Achilles tendons showed an increase in total cholesterol to 15.36 mmol/l. Target sequencing of 14 genes responsible for hypercholesterolemia revealed variants in LDLR gene: c.1889G>C (p.S630T) and c.663_683dupCTGCAAGGACAAATCTGAGGA in a compound heterozygous form.

We analyzed the DNA methylation level of MIR21 gene (proposed promoter, CpG island and gene body) by targeted bisulfite sequencing in blood vessels and leukocytes of patients with carotid artery atherosclerosis and in blood leukocytes of healthy individuals. We detected DNA hypomethylation at the CpG sites in the MIR21 gene in the blood vessels compared to the leukocytes (regardless of the disease). At the same time, 4 consecutive CpG sites of the MIR21 gene body were significantly hypomethylated in atherosclerotic carotid plaque compared to nearby macroscopically intact tissue. Thus, we have shown the tissue specificity at the CpG sites in the MIR21 gene for vessels and its association with carotid artery atherosclerosis.

We analyzed DNA methylation profiles within genes of miR-10b and TWIST1 regulating the expression of this microRNA in blood vessels and blood leukocytes of patients with advanced atherosclerosis and in relatively healthy individuals. MIR10B hypomethylation was detected in arteries affected by atherosclerosis in comparison with unaffected arteries and veins. Methylation profile of TWIST1 gene was tissue-specific and consistent regardless of atherosclerosis.

Non-coding regulatory RNAs are known to affect gene function. We found earlier a negative correlation of high-density lipoprotein cholesterol (HDL-C) with transcripts of some genes involved in HDL metabolism and atherogenesis. In this work, we searched for circular RNA of HDLBP and TNFRSF1A genes in mononuclear cells of patients with different level of HDL-C. The network of competitive interactions of siRNAs with mRNA or circRNA of these genes are predicted by bioinformatic analysis. These circRNAs are suggested to function as the competitive endogenous molecules that are involved in the regulation of gene function.

In our previous studies, we found a deletion (Δ3AB) that led to the gene fusion of APOBEC3A and APOBEC3B in patients with coronary heart disease and metabolic syndrome. The protein products of the APOBEC3A and APOBEC3B genes are involved in the regulation of low-density lipoproteins (apoB), which is a key factor of atherogenicity. Aim. Assess the frequency of deletion at the APOBEC3A-APOBEC3B locus in relation to the risk of developing atherosclerosis with comorbidities. Materials and methods. Patients with carotid atherosclerosis and with different comorbidity of acute cerebrovascular accident (ACVA) and type 2 diabetes mellitus (DM) (n = 118), and control group (n = 96). To assess CNV used digital droplet PCR (ddPCR). Results. It was shown that a heterozygous deletion Δ3AB has a low frequency in the studied groups (12% on average). No differences in the frequency of alleles and genotypes between patients and the control group were found. However, in patients with carotid atherosclerosis and without both ACVA and DM (n = 39), no carriers of this CNV were detected. In contrast, the frequency of heterozygous deletion (Δ3AB) in the other patient groups between 11% to 16%. Summary. For the first time, a Δ3AB deletion frequency was found to be 12%. It is suggested that this CNV may increase the risk of ACVA and DM.

We analyzed the LINE-1 methylation level in carotid atherosclerotic plaques, macrophages and smooth muscle cells isolated from plaques and in the blood leukocytes of patients with clinically significant atherosclerosis and leukocytes of healthy donors. A reduced level of LINE-1 methylation in atherosclerotic plaques was detected compared to leukocytes, as well as it was associated with the histological features of carotid plaque instability.

The contribution of single-nucleotide polymorphisms (SNPs) rs3025039, rs833061, rs3025000 and rs833068 of the VEGF gene to the development of CHD was studied. The Association of rs3025039, rs833061 and rs3025000 with CHD in men was established. The study of haplotypes established associations rs833061T-rs833068A-rs3025000T-rs3025039C and rs833061T-rs833068G-rs3025000C - gs3025039c with a reduced risk of CHD in men, haplotype rs833061C-rs833068G-rs3025000C-rs3025039T and rare haplotypes (frequency <1%) - with an increased risk of CHD in men CHD in women. It was also found that the rs833061T allele is in a negative coupling disequilibrium (LD) with the rs833068G and rs3025000C alleles in men and a positive LD in women, and rs3025039 is in a weak positive LD with the SNP rs3025039 in men.

Currently, restenosis is a major challenge arising after percutaneous coronary interventions. Causes of re-narrowing of the artery after stenting include clinical, angiographic, and genetic factors. Some polymorphic loci of the renin-angiotensin-aldosterone system, folate cycle, and endothelial nitric oxide synthase genes have been studied. Genetic variants associated with the restenosis developing at different time periods after stent implantation (within the first 6 months or later) have been identified.

Obesity is linked to increased cardiometabolic risk. Our study shows that cholesterol transporters ABCA1 and ABCG1 gene expression plays a role in development of obesity, dyslipidemia, metabolic syndrome and ischemic heart disease.

The nature of the nutrition of the inhabitants of the North is from lipo-lipid. Among them, the number of obese people increased, due not only to the variable nature of nutrition, but also to physical inactivity. The aim of the study is to study the genetic component of eating disorders. In total, 191 people took part in the study, of which 100 people suffer from obesity of varying severity (73 women and 27 men), which allows us to compare a sample of people with normal MMT ((25) in the amount of 91 people (70 women and 21 men). According to the results of studies, the frequency of occurrence of the mutant allele A of rs9939609 FTO gene in all the studied groups is 27%, while the AA genotype is only 9.4%. An analysis of the distribution of alleles and genotypes of rs27072 polymorphism of the DAT1 gene showed the predominance of the ancestral G allele (90.8%) and the GG genotype (82.7%) in all examined samples.

Imbalance in the secretion of adipose tissue adipokines may play a role in the development of cardiovascular diseases associated with obesity. Investigation of adiponectin and omentin-1 genes expression levels in adipose tissue was conducted in patients with obesity and coronary artery disease (CAD). Our study has shown that reduced adiponectin serum concentration and subcutaneous adipose tissue gene expression may contribute to CAD development. CAD is associated with a low serum omentin-1 concentration.

This paper presents the results of an analysis of the functional significance of polymorphic loci associated with arterial hypertension, according to the GWAS catalog. Functional effects of polymorphic loci were studied using the online software HaploReg (v4.1), PolyPhen-2, and GTEx portal. The following was selected for the study 10 SNPs (rs167479, rs8068318, rs7302981, rs4387287, rs932764, rs633185, rs2681472, rs1173771, rs1799945, rs805303) associated with the development of arterial hypertension, according to at least 3 full-scale studies. It was found that all polymorphic loci have an important functional role in the body: 3 SNPs are nsSNPs, 9 SNPs are associated with the expression of 74 genes, 5 SNPs are associated with the level of alternative splicing of the transcript of 69 genes.

The paper presents results of processing sequences of 6th exon CYP11B2 taken from 40 DNA samples of patients diagnosed with arterial hypertension. Site rs4538 (NC_000008.11:g.142913286G>T, NM_000498.3:c.1120C>A) revealed a high mutation frequency. The carrier frequencies of allelic variants G and T were 0.556 and 0.444 respectively. The aldosterone content in the blood serum samples averaged 206.1 pg/ml, with high variation in concentrations ranging from 18.18 pg/ml to 933.8 pg/ml. Preliminary evaluation of polymorphism association showed that aldosterone levels were higher for allele T variant (224.0 pg/ml) than for G (191.7 pg/ml).

A total of 1814 patients with arterial hypertension, coronary heart disease, cerebral stroke and a combination of these diseases and 885 healthy individuals from Central Russia were recruited for the study. Molecular genetic analysis of 18 polymorphisms of redox homeostasis (R-H) genes and analysis of methylation of 4 R-H genes were carried out. Molecular-genetic and epigenetic mechanisms of the involvement of R-H genes in the development of common cardiovascular diseases and their comorbid forms are discussed.

Using real-time PCR, the activating effect of ischemia on the expression of circular RNAs (circRNAs) of Ece1, Mvp, Egfem1 and Cdyl genes, as well as the repressing effect on the expression of circRNA of the Rgs9 gene, is shown in the subcortical structures of the rat brain containing the focus of ischemic damage. Bioinformatics analysis revealed possible cis-regulatory interactions between miRNAs, as well as circRNAs and mRNAs of the studied genes. The result indicates the functional role of these circRNAs in the response of brain cells to ischemia.

Variants of genes in the cytochrome P 450 system and carrier proteins play a role in changing the pharmacokinetics and pharmacodynamics of statins, which can lead to a decrease in the effectiveness of drug therapy and the development of undesirable drug reactions. Aim: to evaluate combinations of SNPs of the CYP3A4, CYP3A5, CYP2C9, CYP2C19, CYP2D6, APOE, SLCO1B1 genes that potentially affect the action of statins in a random sample of patients. In 38 randomly selected patients, 60 SNP were examined using real-time polymerase chain reaction and TaqMan® OpenArray® PGx (ThermoFisherScientific, США). All patients had at least one SNP associated with the effectiveness of statins. In 39%, combinations of at least two SNPs have been identified that potentially affect the action of statins. In 25% of patients, combinations of CYP2C19 (rs4244285, rs12248560 or rs4986893) and CYP2C9 (rs28371688 or rs1799853) variants were revealed. 13% patients had combinations of CYP3A4 (rs55785340 or rs2740574), CYP3A5 (rs77676746), and CYP2D6 (rs5030656, rs1065852, rs28371725 or rs3892097) variants. All variants except rs776746 were heterozygous. In 29% of patients, APOE SNPs were detected. 25% of patients had the CT genotype rs4149056 of the SLCO1B1 gene. The proportion of patients with CT genotype rs4149056 and at least two SNPs genes associated with statin efficacy was 45%. Due to the high prevalence of SNP genes involved in statin metabolism, as well as the insignificant effect of SNP alone, according to the literature, it can be assumed that in order to increase the informativeness of pharmacogenetic testing in statin therapy, it is necessary to study the effect of not individual SNPs, but their combinations.

The results of the study of genetic variants of the key platelet receptor for fibrinogen GPIIb-IIIa, as well as the relationship of genetic variants with quantitative characteristics of the receptor and the functional activity of platelets, were presented.

The synthetic peptide ACTH (4-7) PGP accelerates the regression of neurological disorders in ischemic stroke, but the molecular mechanisms of its action are not completely known. On the model of an hour and a half occlusion of the rat middle cerebral artery, an analysis was made of the effect of the peptide on the expression of a number of genes and proteins involved in signaling pathways leading to inflammation and cell death under conditions of ischemia-reperfusion. It was shown that the peptide 24 hours after the onset of occlusion reduces the level of expression of mRNA of pro-inflammatory cytokines and chemokines IL-1α, IL-1β, IL-6, TNF-α, Cxcl2 and Ccl3 in ischemic brain tissue. The peptide decreased the levels of expression of proteins metalloproteinase MMP-9, transcription factor c-Fos, active JNK kinases wich were increased under ischemia, and prevented ischemic decrease in the level of active transcription factor CREB.

Intracranial aneurysm is a multifactorial connective tissue disease leading to spontaneous subarachnoid hemorrhages. It was identified undescribed heterozygous nucleotide sequence change of the PKD1 gene c.6847G>A in patient with subarachnoid hemorrhage with pathogenic significance.

We studied samples of heart valves obtained during cardiac surgery from 26 patients with infective endocarditis (IE) and 12 patients without this pathology (control group). The expression of innate immune response genes (TLR1, TLR2, TLR4 and TLR6) was evaluated by quantitative polymerase chain reaction. It was found that the TLR2 expression in patients with IE was similar to the control group, while the mRNA level of the TLR1, TLR4 and TLR6 genes in the patients was significantly lower compared to the control.

In a model of experimental rat brain ischemia caused by the right transient middle cerebral artery occlusion using RNA-Seq and real-time PCR, genes that significantly change their activity in the rat brain were revealed. For 38 most active rat genes their human orthologous genes were identified. Using the genotype data from the 1000 genome project (CEU population), we explored the polymorphism of each of the genes and identified the loci showed the maximum number of associations with other polymorphisms (tagSNPs). At the first stage, the polymorphisms in DRD2, CCL23, SOCS3, HSPB1 and CHRM genes were studied. From one to three tagSNPs were selected for further analysis in each gene. Using TaqMan real-time PCR assays, allelic variants of the selected loci were genotyped in 100 patients with ischemic stroke and in 100 controls. In the most cases the frequencies of genotypes of the SNPs in the control group were similar to those in the group of patients with ischemic stroke. The most substantial differences in the distribution of genotypes between the groups (p = 0.088) were demonstrated for the SNP rs8069976 from the region of SOCS3 gene. To clarify the direction of the differences revealed, their testing in the patient and control samples of larger sizes is planned.

The present study included 60 unrelated Russian children with non-type 1 diabetes mellitus diagnosed before the age of 18 years. Genetic variants were analyzed using whole-exome sequencing (WES) in a panel of 35 genes causative of maturity onset diabetes of the young (MODY) and transient or permanent neonatal diabetes. Verification of the WES results was performed using PCR-direct sequencing. A total of 38 genetic variants were identified in 33 out of 60 patients (55%). The majority of patients (27/33, 81.8%) had variants in MODY-related genes: GCK (n=19), HNF1A (n=2), PAX4 (n=1), ABCC8 (n=1), KCNJ11 (n=1), GCK+HNF1A (n=1), GCK+BLK (n=1) and GCK+BLK+WFS1 (n=1). A total of 6 patients (6/33, 18.2%) had variants in MODY-unrelated genes: GATA6 (n=1), WFS1 (n=3), EIF2AK3 (n=1) and SLC19A2 (n=1). A total of 15 out of 38 variants were novel, including GCK, HNF1A, BLK, WFS1, EIF2AK3 and SLC19A2. To summarize, the present study demonstrates a high frequency and a wide spectrum of genetic variants causative of monogenic diabetes in Russian children with non-type 1 diabetes mellitus. The spectrum includes previously known and novel variants in MODY-related and unrelated genes, with multiple variants in a number of patients. The prevalence of GCK variants indicates that diagnostics of monogenic diabetes in Russian children may begin with testing for MODY2. However, the remaining variants are present at low frequencies in 9 different genes, altogether amounting to ~50% of the cases and highlighting the efficiency of using WES in non-GCK-MODY cases.

We have studied the genetic component of the age of onset of type 1 diabetes (T1D). We examined a group of patients with T1D (n = 330), which was divided into subgroups with different ages of manifestation of T1D (up to 30 years, n = 269, from 31 years old, n=61). A total of 289 healthy population individuals were enrolled in this study. We studied 58 SNPs of 47 genes whose products are involved in various metabolic pathways as well as fibrogenesis, endothelial dysfunction, the immune response and inflammation. We performed genotyping by mass spectrometry using a Sequenom MassARRAY (USA). As a result, we identified an association with the manifestation age of T1D up to 30 years for rs1007856 of the gene ITGB5 (genotype TT, p=0,02), rs3765124 of the gene ADAMDEC1 (genotype AA, p=0,01). Differences received when comparing subgroups of T1D with different ages of manifestation: for rs1107946 of the gene COL1A1 (genotype AA, p=0,03) and rs514921 of the gene MMP1 (genotype AA, p=0,03). Genes whose SNPs have been associated with an age of manifestation of T1D are involved in the metabolism of extracellular matrix and collagen. Identified genetic variants can be considered as markers of the age of onset of T1D.

Type 2 diabetes mellitus (T2DM) is a metabolic multifactorial, genetically determined, life-threatening disease. The development of complications is associated with a chronic immuno-inflammatory process and with the formation of immune complexes. The aim of the study was to analyze the expression profile of a complex of functionally interconnected genes (cytokines, chemokines, and other key molecules of the inflammatory response) in peripheral blood mononuclear cells in patients with T2DM (N = 10) and in the control group (N = 10). Patients and controls were matched by gender, age, and belonged to the Tatars ethnic group. The expression profile of 84 immune response genes was studied by OT-PCR on a BioRad CFX96TM instrument using the Human Cytokines & Chemokines PCR Array RT2 Profiler PCR Arrays kit (Qiagen). Significant changes in expression (p <0.05) in the general group of patients with T2DM compared with the control were found for the FASLG, IL16, OSM, CSF1, CXCL16, BMP6 genes. Moreover, the expression profile of these genes in patients with type 2 diabetes is characterized by an increase in the level from 2.1 to 6.7 times in comparison with healthy individuals. The gene expression profile of CXCL8, CXCL1, CXCL2, CXCL10, CCL2, IL1RN is characterized by a decrease in the level from 2.1 to 8.78 times in comparison with healthy individuals. Significant statistical differences with a decrease in expression were obtained for the genes IL1RN (fold-change (FCh) = - 3.31, p = 0.013), CXCL1 (FCh = -2.74, p = 0.027), CXCL2 (FCh = -2.66, p = 0.038) . The most significant increase in transcriptional activity was shown for the genes IL16 (FCh = 6.72, p = 0.037) and FASLG (FCh = 2.83 p = 0.034) among patients with type 2 diabetes compared with the control group.

The aim of this work is study the association of rs2237892 and rs6773957 with T2D in a case-control study. Two groups was formed based on the case - control study. The T2D group is 443 person (mean age 56.2 years, men - 28.8 %, women - 66.2 %), the control group was selected according to the sex and age from the DNA bank of project Health, Alcohol and Psychosocial factors In Eastern Europe (HAPIEE) (n = 532, mean age 56.1 years, men - 33.8 %, women - 66.2 %). DNA was isolated by phenol-chloroform extraction. Genotyping was done by PCR followed by analysis of restriction fragment length polymorphism. Statistical processing was performed using the SPSS 16.0 software package. The genotypes frequencies of rs2237892 of the KCNQ1 gene and rs6773957 of the ADIPOQ gene did not show statistically significant differences. There was no significant effect of rs2237892 of the KCNQ1 gene and rs6773957 of the ADIPOQ gene on the risk of developing type 2 diabetes.

For the first time an analysis of the frequencies of alleles polymorphism of the genes UCP1 (rs1800592), UCP2 (rs659366) and UCP3 (rs2075577) were studied in the Yakut and Chukchi populations, living in the extreme climate of Eastern Siberia.

Genes of DNA repair proteins are interesting from the point of view of involvement of formation of common diseases. We studied variability of 8 SNP in the six DNA repair proteins genes in different age cohorts of residents of Tomsk. For rs473297 (MRE11), age-dependent changes alleles and genotypes frequencies were identified: for the older age cohort of the population sample, differences in alleles and genotypes frequencies were recorded with both the younger cohort (p=0.04 and p=0.047, respectively) and long-livers (p=0.02 and p=0.047, respectively). Allele T rs473297 is associated, on the one hand - with longevity (p=0.02, due to genotypes TT and GT), on the other - with mortality from cardiac death under 55 years of age (only homozygotes TT, p=0.03). That is, rs473297 (MRE11) may be involved in determining lifetime through selective survival of carriers of different genotypes suffering from common diseases.

In order to study the molecular mechanisms of action of the peptides of the melanocortin series, a comparative analysis of the effect of Semax and its structural analogue of ACTH(6-9)PGP on transcripts of rat hippocampus under normal and acute stress conditions was performed using the RNA-Seq method. The results revealed common and specific effects of peptides in the regulation of gene expression under acute stress and normal conditions. We proposed a model for the formation of transcriptome response to peptide administration based on allosteric interaction of peptides with receptors.

Owing to the increase of the number of elderly people among the population of the developed countries, the identification of biological and environmental factors contributing to the preservation of their physical and mental activity is of great importance. On the sample of 767 Bashkirs aged from 1 to 105 years old, residents of the Republic of Bashkortostan, the analysis of associations between polymorphic loci of seven genes of the enzymes of free radical and toxic compounds metabolism and the age was performed using PCR method. The frequency of the MSRA*C allele is higher in the group of aging people than in the group of the people aged 1-60 years (p=0,036); the chances of reaching the senile age are increased among carriers of the MSRA*C/C genotype in the age range of 28-75 years (OR=1,048, p=0,038). A decrease of the chances of detecting the CAT*C/C genotype was revealed in the age range up to 70 years (OR=0,979, p=0,028). The NAT2*G/G genotype occurs with a higher frequency among centenarians than in the group of middle-aged people (p=0,04). The frequencies of the SOD1*A allele and the SOD1*A/A genotype are higher among centenarians compared with people of senile age (p=0,05). Polymorphic loci of the SOD1, CAT, MSRA and NAT2 genes can be considered as potential pharmacogenetic markers in the choice of therapy for elderly people.

An algorithm is proposed for developing a mathematical model of selection for national teams, personalized medicine and rehabilitation of the health status of outstanding athletes.