
Медицинская генетика

Расширенный поиск
Доступ открыт Открытый доступ  Доступ закрыт Только для подписчиков
Том 19, № 5 (2020)


6-8 137
Гипертрофическая кардиомиопатия (ГКМП) - самая распространённая форма наследственных заболеваний сердца с преимущественно аутосомно-доминантным типом наследования. Однако до сих пор не выявлены все гены, которые могут быть связаны с патогенезом ГКМП. В связи с этим, целью данной работы стали изучение и поиск новых генетических факторов, связанных развитием ГКМП в российской популяции.
9-10 66
В работе представлены результаты секвенирования пяти генов, ассоциированных с гипертрофической кардиомиопатией, с использованием технологии мономолекулярного секвенирования компании Oxford Nanopore Technologies. В результате анализа данных с помощью различных алгоритмов были выявлены миссенс-варианты в исследованных генах, которые могут являться причиной заболевания у пациентов.
11-13 56
Первичные кардиомиопатии (КМП) относятся к прогрессирующим заболеваниям миокарда, характеризующимся разнообразием симптомов и риском внезапной сердечной смерти. Признаки сочетаний КМП (комплексные фенотипы) все чаще диагностируются в клинике. Клиническое и генетическое обследование было выполнено 186 пациентам, у 9 (4,8%) пробандов выполнялись диагностические критерии сразу двух типов КМП. Потенциально патогенные генетические варианты, ассоциированные с развитием исследуемых типов КМП, были обнаружены как в десмосомных, так и в саркомерных генах у 4 из 9 пробандов.
14-15 61
Дилатационная кардиомиопатия - тяжелое прогрессирующее заболевание миокарда с широким полиморфизмом генетических причин и клинических проявлений. Мутации в гене TNNT2 ответственны примерно за 6% случаев диагностированной семейной ДКМП. Нами был изучен спектр мутаций в гене TNNT2 у 92 неродственных пробандов с первичной ДКМП. Все клинически релевантные находки оказались сосредоточены в 173 положении белка тропонина Т, при этом наблюдаемый клинический полиморфизм у разных носителей варианта был обусловлен различными дополнительными факторами как наследственной, так и ненаследственной природы.
16-17 92
В настоящем исследовании описан новый случай выраженной дилатационной кардиомиопатии (ДКМП) с ранним дебютом. В семейном анамнезе присутствуют как фенотипы ДКМП разной степени тяжести, так и врожденные структурные пороки сердца. С использованием технологии высокопроизводительного секвенирования был охарактеризован полный спектр генетических вариантов в экзоме пациентки. В результате анализа выявлен новый вероятно-патогенный миссенс вариант в гене MYH7, кодирующем бета тяжелую цепь сердечного миозина (экзон 27, c.G3578T, p.R1193L). Кроме того, найден новый миссенс вариант с неопределенной клинической значимостью в гене TBX5, кодирующем транскрипционный фактор T-box 5 (экзон 7, c.T988A, p.C330S, ENST00000526441). Полученные данные свидетельствуют о том, что комбинация двух генетических вариантов в кардиальных генах может приводить к усилению клинического фенотипа ДКМП.
18-19 57
Представлены два случая аритмогенной правожелудочковой кардиомиопатии (АПЖК) с вовлечением левого желудочка и кожными проявлениями у неродственных пациентов. Методом NGS в обоих случаях выявлены новые варианты в консервативных позициях гена интегрин-связанной киназы (ILK) - p.T181A и p.I188T. Изменения в работе ILK нарушают контакты клеток c матриксом и проведение сигналов, вызывая развитие кардиомиопатий, блистеринг и гиперплазию эпидермиса. С большой вероятностью замены p.T181A и p.I188T являются причиной развития АПЖК и неспецифических кожных проявлений у представленных в статье пациентов, однако требуют дополнительных исследований.
20-22 66
Проведен поиск мутаций в генах KCNQ1, KCNH2 и SCN5A методом массового параллельного секвенирования (МПС) у 10 пациентов из 8 семей с диагнозом «синдром удлиненного интервала QT» (СУИQT). Для пробоподготовки использована методика целевого обогащения участков ДНК, относящихся к исследуемым генам. В результате проведенной работы выявлено 8 мутаций: 5 из них расположены в гене KCNQ1, 2 мутации - в гене KCNH2, 1 мутация - в гене SCN5A. Во всех случаях были найдены уникальные мутации, не повторяющиеся у неродственных пациентов. Результаты проведенной работы указывают на эффективность использования таргетных панелей для поиска генетических аномалий при СУИQT.
23-24 71
Методом высокопроизводительного секвенирования у пациентов с синдромом Бругада проведен поиск мутаций в генах, ассоциированных с наследственными аритмиями. Половина нуклеотидных замен локализована в генах, кодирующих белки натриевых и калиевых ионных каналов (SCN5A, KCNJ2, KCNJ8, HCN4, KCNQ1). Выявлены мутации в генах, ассоциированных преимущественно с другими каналопатиями и аритмогенными кардиомиопатиями.
25-27 53
Некомпактный миокард левого желудочка (НМЛЖ) характеризуется развитием ряда осложнений, что в сочетании с сопутствующими заболеваниями обычно приводит к полипрагмазии. Фармакогенетическое тестирование (ФГТ), направленное на выявление вариантов генов, ассоциированных с метаболизмом лекарственных препаратов (ЛП), может позволить подобрать наиболее эффективную и безопасную лекарственную терапию в каждом конкретном случае. В исследование было включено 16 больных с НМЛЖ, его осложнениями и другими заболеваниями. Всем пациентам проводилась оценка 60 однонуклеотидных полиморфизмов (SNP) с помощью полимеразной цепной реакции в реальном времени в амплификаторе QuantStudio 12KFlexReal-TimePCRSystem (ThermoFisherScientific, США). По результатам ФГТ выявлено 62,5% пациентов с НМЛЖ, генотипы которых ассоциированы с изменением метаболизма ЛП. У 12,5% пациентов в анамнезе прием ЛП, требующих коррекции дозы или замены на другой ЛП с учетом результатов ФГТ.
28-30 77
Анализ результатов 10-летней работы лаборатории медицинской генетики показал необходимость развития новых отраслей генетики для формирования персонализированной медицины в России. Совершенствование медико-генетической службы на базе многопрофильного хирургического центра дает большие преимущества в развитии семейных обследований.
31-32 97
Проведено исследование полиморфизма митохондриального генома и числа копий мтДНК в клетке при внезапной сердечной смерти (ВСС). Выявлено более низкое значение числа копий мтДНК в миокарде умерших ВСС. Анализ полиморфизма мтДНК показал более высокую частоту гаплогруппы Н1 в выборке ВСС, по сравнению с популяцией, а также более высокую частоту миссенс-варианта Ala177Thr в гене ATP6 у лиц, переживших остановку сердца. Результаты исследования указывают на связь полиморфизма мтДНК и числа копий мтДНК в клетке с риском внезапной сердечной смерти.
33-35 66
Целью исследования является подтверждение ассоциации с внезапной сердечной смертью однонуклеотидных полиморфизмов rs77270326, rs34643859, выявленных в ходе собственного полноэкзомного секвенирования как возможных молекулярно-генетических маркеров внезапной сердечной смерти. В группе внезапной сердечной смерти (n=400, средний возраст умерших 53,2±8,7 года, доля мужчин - 70,9%, женщин - 29,1%) и контрольной группе (n=400, средний возраст 53,1±8,3 года, мужчины - 68,3 %, женщины - 31,7%) проведено генотипирование по выбранным полиморфизмам методом ПЦР-ПДРФ по авторским протоколам. По частотам генотипов и аллелей полиморфизма rs77270326 не найдено статистически значимых различий между группами (p>0,05). В группе женщин в возрасте до 50 лет выявлено статистически значимое уменьшение доли носительниц генотипа ТТ в группе внезапной сердечной смерти (32,3%) по сравнению с контрольной группой (60,0%) (ОШ=0,32, 95%ДИ 0,11-0,91, р=0,04). Таким образом, однонуклеотидный полиморфизм rs77270326 не ассоциирован с внезапной сердечной смертью. Для женщин младше 50 лет генотип ТТ полиморфизма rs34643859 ассоциирован с протективным эффектом в отношении внезапной сердечной смерти.
36-38 66
Цель исследования: поиск причинных мутаций в генах-кандидатах внезапной сердечной смерти (ВСС) у мужчин, умерших в возрасте до 45 лет. Группа ВСС (30 образцов) была сформирована c использованием критериев ВСС ВОЗ и Европейского общества кардиологов. Средний возраст 31,3±5,3 года. Геномную ДНК выделяли из ткани миокарда методом фенол-хлороформной экстракции. Выполнили секвенирование клинического экзома. На первом этапе проанализировали результаты секевнирования 16 генов, мутации в которых приводят к ССЗ, ассоциированным с повышенным риском ВСС: KCNQ1, KCNH2, SCN5A, AKAP9, ANK2, CACNA1C, CALM1, CALM2, CAV3, KCNE1, KCNE2, KCNJ2, KCNJ5, SCN4B, SNTA1, SCN10A. Из 30 образцов с ВСС при анализе результатов секвенирования 16 генов было обнаружено 6 вероятно патогенных миссенс-мутаций в 7 образцах (23,3 %). В гене SCN10A обнаружено 2 мутации, в KCNH2, KCNE1, AKAP9, SNTA1 - по одной мутации. Подводя первые итоги пилотного исследования ВСС можно сделать следующие предварительные выводы: необходимо продолжение исследований в области молекулярной аутопсии в России, для повышения результативности поиска причинных мутаций, желательны снижение возраста случаев ВСС включаемых в исследование, а также работа с семьями умерших ВСС.
39-40 65
Описан клинический случай гомозиготной формы гиперхолестеринемии. У пациентки с признаками дисплазии соединительной ткани (переразгибание локтевых и коленных суставов), наличием ксантом на локтях обоих рук и на ахилловых сухожилиях, выявлено повышение общего холестерина до 15,36 ммоль/л. При таргетном секвенировании 14-ти генов, ответственных за гиперхолестеринемию выявлено 2 варианта в гене LDLR: с.1889G>C (p.S630T) и c.663_683dupCTGCAAGGACAAATCTGAGGA в компаунд-гетерозиготном состоянии.
41-43 73
Методом таргетного бисульфитного секвенирования проанализирован уровень метилирования предполагаемого промоторного региона, CpG-островка и «тела» гена MIR21 в сосудах и лейкоцитах крови у пациентов с атеросклерозом сонных артерий, а также в лейкоцитах крови здоровых индивидов. Выявлено гипометилирование CpG-сайтов в гене MIR21 в сосудах по сравнению с лейкоцитами (вне зависимости от наличия заболевания). В атеросклеротической бляшке 4 последовательных CpG-сайта «тела» гена MIR21 оказались значимо гипометилированы относительно предлежащей макроскопически интактной части сонной артерии. Таким образом, установлена тканеспецифичность метилирования CpG-сайтов в гене MIR21 в сосудах, а также его связь с атеросклерозом сонных артерий.
44-45 89
В работе проведен анализ профилей метилирования гена miR-10b и гена транскрипционного фактора TWIST1, регулирующего экспрессию данной микроРНК, в кровеносных сосудах и лейкоцитах крови пациентов с клинически выраженным атеросклерозом и у относительно здоровых лиц. Обнаружено гипометилирование MIR10B в поражённых атеросклерозом артериях относительно непораженных артерий и вен. Профиль метилирования гена TWIST1 был тканеспецифичен и постоянен вне зависимости от наличия заболевания.
46-47 70
Известно, что некодирующие регуляторные РНК влияют на функцию генов. Ранее мы обнаружили отрицательную корреляцию уровня холестерина липопротеинов высокой плотности (ХС-ЛВП) с содержанием транскриптов ряда генов, участвующих в метаболизме ЛВП и в атерогенезе. В данной работе проведен поиск циклических РНК генов HDLBP и TNFRSF1A, а также анализ их представленности в мононуклеарных клетках пациентов с различающимся содержанием ХС-ЛВП. С помощью биоинформатического анализа предсказаны сети возможных конкурентных взаимодействий миРНК с мРНК или циклоРНК данных генов. Сделано предположение, что обнаруженные циклические РНК играют роль конкурентных эндогенных молекул, участвующих в регуляции функционирования соответствующих генов.
48-49 61
В наших предыдущих работах при исследовании генома пациентов с ишемической болезнью сердца и метаболическим синдромом выявлена делеция (Δ3AB), приводящая к слиянию генов APOBEC3A и APOBEC3B с образованием химерного гена APOBEC3A/3B. Белковые продукты генов APOBEC3A и APOBEC3B участвуют в регуляции липопротеидов низкой плотности (apoB), одного из ключевых факторов атерогенности. Цель исследования - оценить частоту делеции в локусе APOBEC3A-APOBEC3B в отношении риска развития атеросклероза и его осложнений. Выборку для исследования составили пациенты с каротидным атеросклерозом и с разными сочетаниями с острым нарушением мозгового кровообращения (ОНМК) и сахарным диабетом 2 типа (СД2) (n=118), и контрольная группа (n=96). Оценка производилась методом цифровой капельной ПЦР (ddPCR). Выявлено, что гетерозиготная делеция, приводящая к формированию химерного гена APOBEC3А/3B, имеет в целом низкую частоту в исследованных группах (12% в среднем). Различий по частоте аллелей и генотипов между пациентами и контрольной группой не было обнаружено. Однако у пациентов с каротидным атеросклерозом, но без ОНМК и СД2 (n=39) не было выявлено лиц носительства данной CNV. В тоже самое время, частота гетерозиготной делеции (Δ3AB) в остальных группах составила от 11% до 16%. Таким образом, впервые установлена частота делеции Δ3AB и показано, что наибольшая частота делеции Δ3AB наблюдается у больных с каротидным атеросклерозом в сочетании с ОНМК и СД2.
50-51 50
В работе проведен анализ уровня метилирования ретротранспозона LINE-1 в атеросклеротических бляшках сонных артерий, выделенных из них макрофагах и гладкомышечных клетках, а также в лейкоцитах периферической крови пациентов с клинически выраженным атеросклерозом и в лейкоцитах здоровых доноров. Выявлен сниженный уровень метилирования LINE-1 в атеросклеротических бляшках по сравнению с лейкоцитами крови пациентов, а также его связь с гистологическими признаками нестабильности атеросклеротической бляшки.
52-53 128
Изучен вклад однонуклеотидных полиморфизмов (SNPs) rs3025039, rs833061, rs3025000 и rs833068 гена VEGFA в развитие ишемической болезни сердца (ИБС). Установлена ассоциация rs3025039, rs833061 и rs3025000 с ИБС у мужчин. При изучении гаплотипов установлены ассоциации rs833061T-rs833068A-rs3025000T-rs3025039C и rs833061T-rs833068G-rs3025000C- rs3025039С с пониженным риском развития ИБС у мужчин, гаплотипа rs833061C-rs833068G-rs3025000C-rs3025039T и редких гаплотипов (частота <1%) - с повышенным риском развития ИБС у женщин. Также в работе было выявлено, что аллель rs833061T находится в отрицательном неравновесии по сцеплению (LD) с аллелями rs833068G и rs3025000C у мужчин и положительном LD у женщин, а rs3025039 - в слабом положительном LD с SNP rs3025039 у мужчин.
54-55 88
В настоящее время рестеноз является основной проблемой, возникающей после чрескожных коронарных вмешательств. К причинам повторного сужения артерии после стентирования относятся клинические, ангиографические и генетические факторы. В представленной работе изучены некоторые полиморфные локусы генов ренин-ангиотензин-альдостероновой системы, фолатного цикла и эндотелиальной синтазы оксида азота. Выявлены генетические варианты, ассоциированные с рестенозом, развивающимся в различные сроки после стентирования (до 6 месяцев или позже).
56-57 67
Ожирение ассоциировано с повышенным риском развития метаболических нарушений и сердечно-сосудистых заболеваний. В нашем исследовании мы показали, что экспрессия генов транспортеров холестерина ABCA1 и ABCG1 в жировой ткани может играть роль в развитии ожирения, дислипидемии, метаболического синдрома и ишемической болезни сердца (ИБС).
58-59 80
Характер питания коренных жителей Севера сменился с белково-липидного на углеводно-липидный. Среди них увеличилось число лиц, страдающих ожирением, обусловленном не только сменой характера питания, но и гиподинамией. Целью исследования является изучение генетической составляющей нарушения пищевого поведения в выборке якутов с ожирением. Всего в исследовании принял участие 191 человек якутской национальности, из них 100 пациентов страдающих ожирением различной степени тяжести (73 женщины и 27 мужчин), в качестве группы сравнения сформирована выборка людей с нормальными показателями ИМТ (< 25) в количестве 91 человека (70 женщин и 21 мужчина). По результатам исследования, частота встречаемости мутантного аллеля А rs9939609 гена FTO во всей обследованной группе составила 27%, при этом доля лиц с генотипом АА составляла 9,4 %. Анализ распределения аллелей и генотипов полиморфизма rs27072 гена DAT1 показал преобладание предкового аллеля G (90,8 %) и генотипа GG (82,7 %) во всех обследованных группах.
60-61 87
Дисбаланс в секреции адипокинов жировой тканью при ожирении может играть роль в развитии сердечно-сосудистых заболеваний. Нами было проведено исследование уровня экспрессии генов адипонектина и оментина-1 в жировой ткани у лиц с ожирением и ишемической болезнью сердца (ИБС). Показано, что сниженные концентрация в сыворотке крови и экспрессия гена адипонектина в подкожной жировой ткани могут вносить вклад в развитие ИБС при ожирении. ИБС ассоциирована с низкой концентрация оментина-1 в сыворотке крови.
62-63 159
Представлены результаты анализа функциональной значимости полиморфных локусов, ассоциированных с артериальной гипертензией (АГ), по данным каталога GWAS. Функциональные эффекты полиморфных локусов были изучены с использованием онлайн программного обеспечения HaploReg (v4.1), PolyPhen-2, GTEx portal. Для исследования было отобрано 10 SNPs (rs167479, rs8068318, rs7302981, rs4387287, rs932764, rs633185, rs2681472, rs1173771, rs1799945, rs805303), ассоциированных с развитием АГ, по данным не менее чем 3 полногеномных исследований. Установлено, что все полиморфные локусы играют важную функциональную роль: 3 из них являются nsSNPs, 9 имеют связь с экспрессией 74 генов, 5 ассоциированы с уровнем альтернативного сплайсинга транскрипта 69 генов.
64-65 60
Обсуждаются результаты анализа последовательности 6 экзона гена CYP11B2 в 40 образцах ДНК пациентов с диагнозом артериальная гипертензия. Выявлена высокая частота мутации в сайте rs4538 (NC_000008.11:g.142913286G>T). Частота носителей аллелей G и Т составила 0,556 и 0,444 соответственно. Уровень содержания альдостерона в сыворотке крови у обследованных в среднем составил 206,1 пг/мл; обнаружена высокая вариация в концентрациях - от 18,18 пг/мл до 933,8 пг/мл. Предварительная оценка ассоциации полиморфизма показала, что при носительстве аллельного варианта Т уровень альдостерона выше (224,0 пг/мл), чем при G (191,7 пг/мл).
66-68 81
В исследование были включены 1814 пациентов с артериальной гипертензией, ишемической болезнью сердца, мозговым инсультом и сочетанием этих заболеваний и 885 здоровых индивидов из Центральной России. Проведен молекулярно-генетический анализ 18 полиморфных вариантов генов редокс-гомеостаза (Р-Г) и анализ метилирования 4 генов Р-Г. Обсуждаются молекулярно-генетические и эпигенетические механизмы вовлеченности генов Р-Г в формирование распространенных сердечно-сосудистых заболеваний и их коморбидных форм.
69-70 62
Методом ПЦР в реальном времени в подкорковых структурах мозга крыс, содержащих очаг ишемического повреждения, показано активирующее влияние ишемии на экспрессию циклических РНК (циклоРНК) генов Ece1, Mvp, Egfem1 и Cdyl, а также репрессирующее влияние на экспрессию циклоРНК гена Rgs9. Биоинформатический анализ выявил возможные цис-регуляторные взаимодействия между микроРНК, а также циклоРНК и мРНК исследуемых генов, что указывает на функциональную роль данных циклоРНК в ответе клеток мозга на ишемию.
71-73 60
Варианты генов в системе цитохрома Р 450, белков-переносчиков играют роль в изменении фармакокинетики и фармакодинамики статинов, что может приводить к снижению эффективности медикаментозной терапии, развитию нежелательных лекарственных реакций. Цель: оценить сочетания вариантов нуклеотидной последовательности (ВНП) генов CYP3A4, CYP3А5, CYP2C9, CYP2C19, CYP2D6, APOE, SLCO1B1, потенциально влияющих на действие статинов, в случайной выборке больных. У 38 случайно отобранных пациентов исследовали 60 ВНП методом полимеразной цепной реакции в реальном времени, используя экспресс-панель TaqMan® OpenArray® PGx (ThermoFisherScientific, США). У всех пациентов был выявлен как минимум один ВНП, связанный с эффективностью статинов. У 39 % выявлены сочетания как минимум двух ВНП, потенциально влияющих на действие статинов. У 25% пациентов выявлены сочетания вариантов CYP2C19 (rs4244285, rs12248560 или rs4986893) и CYP2C9 (rs28371688 или rs1799853). У 13% пациентов выявлены сочетания вариантов CYP3А4 (rs55785340 или rs2740574), CYP3А5 (rs776746) и CYP2D6 (rs5030656, rs1065852, rs28371725 или rs3892097). У 29% выявлены ВНП APOE, потенциально изменяющие эффект статинов. 25% пациентов имели генотип СT rs4149056 гена SLCO1B1. Доля пациентов с генотипом СТ rs4149056 и как минимум двумя ВНП генов, ассоциированных с эффективностью статинов, составила 45%. Ввиду высокой распространенности ВНП генов, участвующих в метаболизме статинов, а также незначительного эффекта одного ВНП, по данным литературы, можно предположить, что для повышения информативности фармакогенетического тестирования при терапии статинами следует изучать влияние не отдельного ВНП, а их сочетаний.
74-75 76
В работе представлены результаты исследования генетических вариантов ключевого тромбоцитарного рецептора для фибриногена GPIIb-IIIa, а также взаимосвязь генетических вариантов с количественными характеристиками рецептора и функциональной активностью тромбоцитов.
76-78 61
Синтетический пептид АКТГ(4-7)PGP ускоряет регресс неврологических нарушений при ишемическом инсульте, однако молекулярные механизмы его действия полностью не известны. На модели полуторачасовой окклюзии средней мозговой артерии крыс был проведен анализ влияния пептида на экспрессию ряда генов и белков, вовлеченных в сигнальные пути, приводящие к воспалению и гибели клеток в условиях ишемии-реперфузии. Показано, что пептид через 24 ч от начала окклюзии снижает повышенный при ишемии уровень экспрессии в ишемизированной ткани мозга крыс мРНК провоспалительных цитокинов и хемокинов IL-1α, IL-1β, IL-6, TNF-α, Cxcl2 и Ccl3. Пептид снижал повышенные при ишемии уровни экспрессии белков металлопротеиназы ММР-9, транскрипционного фактора c-Fos, активных JNK киназ и предотвращал ишемическое снижение уровня активного транскрипционного фактора CREB.
79-80 47
Интракраниальная аневризма - заболевание соединительной ткани многофакторной природы, приводящее к спонтанным субарахноидальным кровоизлияниям. Обнаружено ранее неописанное изменение нуклеотидной последовательности гена PKD1 в гетерозиготном состоянии c.6847G>A с патогенной значимостью у пациентки с субарахноидальным кровоизлиянием.
81-82 67
Изучены образцы створок клапанов сердца, полученные в ходе кардиохирургического вмешательства от 26 пациентов с установленным диагнозом «инфекционный эндокардит» (ИЭ), и от 12 пациентов без данной патологии (контрольная группа). Оценка уровня экспрессии генов врожденного иммунного ответа TLR1, TLR2, TLR4 и TLR6 проводилась методом количественной полимеразной цепной реакции. Установлено, что экспрессия гена TLR2 у пациентов с ИЭ практически не отличалась от контрольной группы, в то время как уровень мРНК генов TLR1, TLR4 и TLR6 в группе пациентов был значительно ниже, чем в контроле.
83-85 141
В условиях модели экспериментальной ишемии мозга крыс, вызванной обратимой окклюзией правой средней мозговой артерии, с использованием методов RNA-Seq и ПЦР в реальном времени были выявлены гены, значительно меняющие свою активность в мозге крыс. Для 38 наиболее активных генов были определены гены-ортологи у человека. С использованием баз данных проекта 1000 геномов (популяция CEU) был изучен полиморфизм каждого из генов и отобраны локусы, которые демонстрировали максимальное число ассоциаций с другими полиморфизмами (tagSNPs). На первом этапе был исследован полиморфизм генов DRD2, CCL23, SOCS3, HSPB1 и CHRM4, в каждом из которых были идентифицированы от одного до трех tagSNPs. С использованием метода ПЦР в режиме реального времени (TaqMan) аллельные варианты отобранных локусов были генотипированы в выборке больных ишемическим инсультом (100 чел.) и контрольной группе (100 чел.). Частоты встречаемости генотипов исследованных полиморфизмов в контрольной группе, в большинстве случаев, оказались близкими таковым в группе больных с ишемическим инсультом. Наиболее существенные различия в распределении генотипов между выборками (p = 0,088) были продемонстрированы для локуса rs8069976 из региона локализации гена SOCS3. Для уточнения направленности выявленных различий планируется их проверка на выборках больных и контроля больших размеров.
86-88 63
Исследованы образцы ДНК 60 пациентов с подозрением на наличие моногенного сахарного диабета (МСД-MODY) путем секвенирования NGS панели 13 генов MODY и 22 гена «неонатального» диабета и синдромальных форм диабета. МСД был подтвержден у 55% (n=33). Из 33 пациентов 27 (81,8%) имели мутации (варианты) в MODY генах. Наиболее часто встречались варианты в гене GCK-31,6% (n=19). Спектр вариантов в гене GCK включал 13 миссенс мутаций, 3 нонсенс, 4 со сдвигом рамки считывания и 1 в промоторной области. Были также выявлены варианты в других генах: HNF1A (n=3), WFS1(n=4), PAX4 (n=1), EIF2AK3 (n=1, гомозигота), GATA6 (n=1), KCNJ11(n=1), ABCC8 (n=1), SLC19A2 (n=2), BLK (n=2). Из 38 детектированных вариантов 15 оказались новыми. Высокая выявляемость может быть связана как с особенностями нашей группы, так и с использованным биоинформатическим подходом. Молекулярно-генетическая верификация диагноза при помощи NGS секвенирования позволяет повысить эффективность диагностики, прогнозировать течение заболевания и вносить коррективы в лечение СД.
89-91 56
В работе изучена генетическая составляющая возраста манифестации сахарного диабета 1-го типа (СД1). В общей группе больных СД1 (n=330), а также в подгруппах с разным возрастом манифестации СД1 (до 30 лет, n=269, с 31 года, n=61) и популяционной выборке (n=289) изучено 58 однонуклеотидных полиморфизмов (SNPs), локализованных в 47 генах, продукты которых участвуют в различных метаболических путях и вовлечены в процессы фиброгенеза, эндотелиальную дисфункцию, иммунный ответ и воспаление. Генотипирование выполнено методом масс-спектрометрии на приборе «Sequenom MassARRAY» (США). В результате выявлена ассоциация с возрастом манифестации СД1 до 30 лет rs1007856 гена ITGB5 (генотип TT, р=0,02), rs3765124 гена ADAMDEC1 (генотип AA, р=0,01). При сравнении подгрупп СД1 с разным возрастом манифестации отличия получены для rs1107946 гена COL1A1 (генотип AA, р=0,03) и rs514921 гена MMP1 (генотип AA, р=0,03). Гены, SNPs которых показали ассоциацию с возрастом манифестации СД1, кодируют белковые продукты, вовлеченные в метаболизм экстрацеллюлярного матрикса и коллагена. Данные варианты могут рассматриваться в качестве маркеров возраста дебюта СД1.
92-94 61
Сахарный диабет 2 типа (СД2) - метаболическое многофакторное, генетически обусловленное, опасное для жизни заболевание. Развитие осложнений связано с хроническим иммуновоспалительным процессом и с образованием иммунных комплексов. Целью исследования явился анализ профиля экспрессии комплекса функционально взаимосвязанных генов (цитокинов, хемокинов и другие ключевые молекулы воспалительного ответа) в мононуклеарах периферической крови у пациентов с СД2 (N=10) и в контрольной группе (N=10). Пациенты и контроль были подобраны по полу, возрасту, принадлежали к этнической группе татар. Профиль экспрессии 84 генов иммунного ответа исследовали методом OT-ПЦР на приборе BioRad CFX96TM набором RT2 Profiler PCR Arrays «Human Cytokines & Chemokines PCR Array» (Qiagen). Значимые изменения экспрессии (p<0,05) в общей группе больных СД2 по сравнению с контролем были установлены для генов FASLG, IL16, OSM, CSF1, CXCL16, BMP6. При этом профиль экспрессии этих генов у больных СД2 характеризуется повышением уровня от 2,1 до 6,7 раз по сравнению со здоровыми индивидами. Профиль экспрессии генов CXCL8, CXCL1, CXCL2, CXCL10, CCL2, IL1RN характеризуется снижением уровня от 2,1 до 8,78 раз по сравнению со здоровыми индивидами. Значимые статистические различия при снижении экспрессии были получены для генов IL1RN (fold-change (FCh)=-3,31, p=0,013), CXCL1 (FCh=-2,74, p=0,027), CXCL2 (FCh=-2,66, p=0,038). Наиболее значимое повышение транскрипционной активности было показано для генов IL16 (FCh=6,72, p=0,037) и FASLG (FCh=2,83 p=0,034) среди больных СД2 по сравнению с контрольной группой.
95-96 63
Цель работы - изучение ассоциации однонуклеотидных полиморфизмов rs2237892 гена KCNQ1 и rs6773957 гена ADIPOQ с сахарным диабетом 2 типа (СД2). На основе проспективного обследования репрезентативной популяционной выборки жителей г.Новосибирска сформированы две группы по принципу «случай - контроль». Группа СД2 (n=443, средний возраст 56,2 лет, мужчины - 28,8%, женщины - 71,2%), группа контроля (n=532, средний возраст 56,1 лет, мужчины - 33,8%, женщины - 66,2%) сформированы из банка ДНК международного исследования HAPIEE. ДНК выделена методом фенолхлороформной экстракции. Генотипирование выполнено методом ПЦР с последующим анализом полиморфизма длин рестрикционных фрагментов. Статистическая обработка проведена с использованием программного пакета SPSS 16.0. По частотам генотипов и аллелей полиморфизмов rs2237892 гена KCNQ1 и rs6773957 гена ADIPOQ не выявлено статистически значимых различий между группами, в том числе и при разделении по полу и возрасту (p>0,05). Значимого влияния rs2237892 гена KCNQ1 и rs6773957 гена ADIPOQ на риск развития СД2 не обнаружено.
97-98 123
Впервые был проведен анализ частот аллелей полиморфизмов генов UCP1 (rs1800592), UCP2 (rs659366) и UCP3 (rs2075577) в популяциях якутов и чукчей, проживающих в условиях экстремального климата Восточной Сибири.
99-100 60
Гены белков репарации ДНК интересны с точки зрения их роли в формировании многофакторных заболеваний. Нами изучена изменчивость 8 SNP в 6 генах белков репарации ДНК в разных возрастных когортах жителей г. Томска. Для rs473297 в гене MRE11 выявлены возраст-зависимые изменения частот аллелей и генотипов: для старшей возрастной когорты зарегистрированы различия по частотам аллелей и генотипов как с младшей когортой (p=0,04 и p=0,047 соответственно), так и с долгожителями (p=0,02 и p=0,047 соответственно). Аллель T rs473297 ассоциирован, с одной стороны, с долгожительством (p=0,02 за счет генотипов TT и GT), с другой - со смертностью от сердечно-сосудистых заболеваний в возрасте до 55 лет (только генотипы TT, p=0,03). То есть, rs473297 в гене MRE11 может быть вовлечен в определение продолжительности жизни через селективную выживаемость носителей разных генотипов, больных сложно-наследуемыми заболеваниями.
101-102 93
В целях исследования молекулярных механизмов действия пептидов меланокортинового ряда был проведен сравнительный анализ действия семакса и его структурного аналога АКТГ(6-9)PGP на транскриптом гиппокампа крыс в норме и условиях острого стресса с помощью метода RNA-Seq. Полученные результаты выявили общие и специфические эффекты пептидов меланокортинового ряда в регулировании экспрессии генов в условиях острого стресса и нормы. Предложена модель формирования ответа транскриптома на введение пептидов, основанная на аллостерическом взаимодействии пептидов с рецепторами.
103-105 125
В связи увеличением числа лиц преклонного возраста в структуре населения развитых стран особенную актуальность приобретает идентификация биологических и средовых факторов, способствующих сохранению физической и умственной активности людей данной возрастной группы. На выборке 767 башкир в возрасте от 1 до 105 лет, жителей Республики Башкортостан, методом ПЦР проведен анализ ассоциаций полиморфных локусов семи генов, кодирующих ферменты метаболизма токсичных соединений и свободных радикалов, с возрастом. В старческой группе частота аллеля MSRA*C выше относительно таковой среди лиц в возрасте 1-60 лет (p=0,036); шансы достижения старческого возраста повышаются у носителей генотипа MSRA*C/C в возрастном диапазоне 28-75 лет (OR=1,048, p=0,038). Выявлено снижение шансов обнаружения генотипа САТ*C/C в возрастном диапазоне до 70 лет (OR=0,979, p=0,028). Генотип NAT2*G/G среди долгожителей встречается с большей частотой, чем в группе лиц среднего возраста (p=0,04). Частота аллеля SOD1*А и генотипа SOD1*А/А выше среди долгожителей в сравнении с лицами старческого возраста (p=0,05). Полиморфные локусы генов SOD1, CAT, MSRA и NAT2 можно рассматривать как потенциальные фармакогенетические маркеры при выборе терапии у лиц старческого возраста.
106-108 57
Предлагается алгоритм разработки математической модели отбора в сборные команды, персонифицированной медицины и реабилитации состояния здоровья выдающихся спортсменов.

ISSN 2073-7998 (Print)