Preview

Medical Genetics

Advanced search

Clinical case of homozygous familial hypercholesterolemia

https://doi.org/10.25557/2073-7998.2020.05.39-40

Abstract

This report describes a clinical case of homozygous hypercholesterolemia. A patient with signs of connective dysplasia (elbow and knee joints hyperextension), presences xanthomatosis of on the elbows of both hands and on Achilles tendons showed an increase in total cholesterol to 15.36 mmol/l. Target sequencing of 14 genes responsible for hypercholesterolemia revealed variants in LDLR gene: c.1889G>C (p.S630T) and c.663_683dupCTGCAAGGACAAATCTGAGGA in a compound heterozygous form.

About the Authors

D. F. Mesitskaya
I.M. Sechenov First Moscow State Medical University of the Ministry of Health of the Russian Federation (Sechenov University)
Russian Federation


M. S. Balashova
I.M. Sechenov First Moscow State Medical University of the Ministry of Health of the Russian Federation (Sechenov University); Center of Genetics and Reproductive Medicine GENETICO Limited Liability Соmраnу
Russian Federation


N. A. Zhuchenko
I.M. Sechenov First Moscow State Medical University of the Ministry of Health of the Russian Federation (Sechenov University)
Russian Federation


A. E. Potapkina
I.M. Sechenov First Moscow State Medical University of the Ministry of Health of the Russian Federation (Sechenov University)
Russian Federation


Review

For citations:


Mesitskaya D.F., Balashova M.S., Zhuchenko N.A., Potapkina A.E. Clinical case of homozygous familial hypercholesterolemia. Medical Genetics. 2020;19(5):39-40. (In Russ.) https://doi.org/10.25557/2073-7998.2020.05.39-40

Views: 553


Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 License.


ISSN 2073-7998 (Print)