Clinical case of homozygous familial hypercholesterolemia

Abstract

This report describes a clinical case of homozygous hypercholesterolemia. A patient with signs of connective dysplasia (elbow and knee joints hyperextension), presences xanthomatosis of on the elbows of both hands and on Achilles tendons showed an increase in total cholesterol to 15.36 mmol/l. Target sequencing of 14 genes responsible for hypercholesterolemia revealed variants in LDLR gene: c.1889G>C (p.S630T) and c.663_683dupCTGCAAGGACAAATCTGAGGA in a compound heterozygous form.