Preview

Медицинская генетика

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
Том 14, № 11 (2015) Анализ полиморфизма C677T гена MTHFR у женщин с преждевременными родами Аннотация  PDF (Rus)  похожие документы
Н. И. Любчич, К. Т. Бобоев
"... An analysis of the presence of C677T mutant allele of MTHFR gene among the women with preterm labor ..."
 
Том 14, № 5 (2015) ИЗУЧЕНИЕ РОЛИ ПОЛИМОРФИЗМА ГЕНОВ СВЁРТЫВАЮЩЕЙ СИСТЕМЫ В ВОЗНИКНОВЕНИИ ПРЕЖДЕВРЕМЕННЫХ РОДОВ У ЖЕНЩИН УЗБЕКСКОЙ ПОПУЛЯЦИИ Аннотация  PDF (Rus)  похожие документы
Н. И. Любчич, К. Т. Бобоев
"... 677T gene MTGFR among the women with preterm labor. The carriers of mutant allele «1691А ..."
 
Том 12, № 2 (2013) ПОЛИМОРФИЗМ C677TГЕНА MTHFR И РИСК ФОРМИРОВАНИЯ НЕСИНДРОМАЛЬНЫХ ОРОФАЦИАЛЬНЫХ РАСЩЕЛИН Аннотация  PDF (Rus)  похожие документы
Т. И. Мещерякова, С. И. Маркова, С. С. Жилина, Г. В. Гончаков, С. Г. Гончакова, А. А. Абрамов, А. Н. Петрин, Г. Р. Мутовин
"... ). The paper presents the analysis of the gene MTHFR C677T polymorphism in 102 children with nonsyndromic Cl/p.   ..."
 
Том 16, № 5 (2017) Полиморфизм генов фолатного цикла у женщин Уральского региона в норме и с привычным невынашиванием беременности Аннотация  PDF (Rus)  похожие документы
Т. Б. Третьякова, Н. С. Демченко, Н. Е. Рукосуев
"... , having one or more healthy children. All women were analyzed the following polymorphisms: MTHFR 677 C>T ..."
 
Том 14, № 11 (2015) Фолатный цикл: обзор и практические рекомендации по интерпретации генетических тестов Аннотация  PDF (Rus)  похожие документы
Н. В. Кох, А. А. Слепухина, Г. И. Лифшиц
"... the association between the methylenetetrahydrofolate reductase (MTHFR) 677C>T polymorphism and blood ..."
 
Том 16, № 3 (2017) Вклад полиморфных вариантов генов фолатного цикла в цитогенетическую нестабильность клеток крови больных раком легкого Аннотация  PDF (Rus)  похожие документы
М. Л. Баканова, О. А. Соболева, В. И. Минина, Я. А. Савченко, А. В. Рыжкова, Р. А. Титов, В. А. Титов, У. А. Боярских, Е. Н. Воронина, А. Н. Глушков
"... aberration analysis; 2) the real-time polymerase chain reaction using TaqMan assay for a study of the MTHFR ..."
 
Том 12, № 1 (2013) АССОЦИАЦИЯ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ ФОЛАТНОГО ЦИКЛА И ИНТЕГРИНОВ С НЕВЫНАШИВАНИЕМ БЕРЕМЕННОСТИ Аннотация  PDF (Rus)  похожие документы
Е. В. Машкина, К. А. Коваленко, Л. В. Гутникова, Е. Г. Деревянчук, Т. П. Шкурат
"... Polymorphism of the gene MTHFR, MTRR, MTR, ITGB3, ITGA2, FGB, SERPINE1 were stud i ed in women ..."
 
Том 14, № 10 (2015) Исследование полиморфизмов гена CYP2C9 у женщин, принимающих вальпроаты Аннотация  PDF (Rus)  похожие документы
Д. В. Дмитренко, Н. А. Шнайдер
"... gene, which encodes 2C9 isoenzyme of P450 liver cytochrome, in women of childbearing age ..."
 
Том 14, № 11 (2015) Редкий хромосомный дисбаланс у плода: опыт применения метода чиповой сравнительной геномной гибридизации (aCGH) (клиническое наблюдение) Аннотация  PDF (Rus)  похожие документы
Н. А. Каретникова, А. Н. Екимов, Е. Е. Баранова, В. А. Бахарев, Д. Ю. Трофимов, А. И. Гус
"... diagnosis // Obstet. Gynecol. — 122(6). — P. 1374—1377. 7. Gorski J.L. et al. Reproductive risks for ..."
 
Том 17, № 12 (2018) Прогностическая значимость неинвазивных пренатальных тестов в группах женщин с высоким и низким риском анеуплоидии плода Аннотация  похожие документы
В. А. Гнетецкая, Е. Е. Баранова, М. С. Беленикин, Ю. А. Тарасова, В. Л. Ижевская, М. А. Курцер
"... prenatal tests (NIPTs), Harmony and Panorama. The pregnant women were divided into the high and low risk ..."
 
Том 17, № 3 (2018) Роль генов ангиогенеза и эндотелиальной дисфункции в формировании структуры наследственной предрасположенности к привычному невынашиванию беременности Аннотация  PDF (Rus)  похожие документы
Е. А. Трифонова, О. А. Ганьжа, Т. В. Габидулина, В. А. Степанов
"... . It is shown that alleles of the 677T gene of the MTHFR gene, 894T of the NOS3 gene, genotypes of the 936CT ..."
 
Том 16, № 5 (2017) Оценка роли полиморфизма генов системы гемостаза и генов, отвечающих за формирование дисфункции эндотелия, в развитии гестационных осложнений Аннотация  PDF (Rus)  похожие документы
О. В. Чуманова, Н. М. Пасман, Е. Н. Воронина, М. Л. Филипенко
"... of women: experimental (n = 257) and control (n = 190). The first group consisted of women with pregnancy ..."
 
Том 15, № 1 (2016) Генетика мигрени Аннотация  PDF (Rus)  похожие документы
Н. С. Кондратьева, А. А. Анучина, З. Г. Кокаева, Е. А. Наумова, Ю. Э. Азимова, А. В. Сергеев, К. В. Скоробогатых, Г. Р. Табеева, Е. А. Климов
"... ãðóïï [62—68] è íåñêîëüêèõ íåäàâíèõ ìåòààíàëèçîâ [65—71] ïîäòâåðäèëè âêëàä àëëåëÿ T677 ãåíà MTHFR (rs ..."
 
Том 15, № 5 (2016) Анализ генофонда и родоплеменной структуры шорцев по маркерам Y-хромосомы Аннотация  PDF (Rus)  похожие документы
В. Н. Харьков, Л. М. Новикова, Ф. А. Лузина, И. Ю. Хитринская, В. А. Степанов
"... Исследована генетическая структура шорских популяций и родов (сеоков) по маркерам Y-хромосомы ..."
 
Том 17, № 1 (2018) Неслучайное распределение кариотипов эмбрионов у женщин с привычным невынашиванием беременности Аннотация  PDF (Rus)  похожие документы
Т. В. Никитина, Д. И. Жигалина, Е. А. Саженова, Е. Н. Толмачева, Н. А. Скрябин, И. Н. Лебедев
"... /51) of women were healthy, 59% (30/51) had diseases associated with miscarriage. Results. The odds ..."
 
Том 16, № 3 (2017) Промоторный полиморфизм rs890293 гена эпоксигеназы CYP2J2 ассоциирован с повышенным риском развития гипертонической болезни у женщин Аннотация  PDF (Rus)  похожие документы
М. А. Быканова, М. А. Солодилова, А. В. Бочарова, К. В. Вагайцева, В. А. Степанов, А. В. Полоников
"... in the distribution of genotypes between hypertensive and healthy women. In particular, the heterozygous genotype -76G ..."
 
Том 18, № 1 (2019) Влияние полиморфизма-344C>T гена альдостеронсинтазыCYP11B2 на риск развития гипертензивных нарушений у беременных узбекской национальности Аннотация  похожие документы
У. А. Ашурова, Д. К. Наджмутдинова, Х. Я. Каримов, К. Т. Бобоев
"... of hypertensive disorders during pregnancy among Uzbek women.Study design: the study included a group of 201 ..."
 
Том 15, № 11 (2016) Гены семейства нейрексинов (CNTNAP2 и NRXN1): их роль в развитии математической тревожности Аннотация  PDF (Rus)  похожие документы
А. В. Казанцева, Р. Ф. Еникеева, А. Р. Романова, С. А. Башкатов, С. И. Галяутдинова, Т. Н. Тихомирова, С. Б. Малых, Э. К. Хуснутдинова
"... in math anxiety. The study involved 523 healthy individuals from Republic of Bashkortostan (75% women ..."
 
Том 18, № 1 (2019) Варианты гена адипонектина (ADIPOQ) rs2441766 и rs266729: ассоциация с концентрацией общего и высокомолекулярного адипонектина сыворотки крови у женщин с абдоминальным ожирением и метаболическим синдромом Аннотация  похожие документы
Д. Л. Бровин, К. В. Драчева, А. А. Пантелеева, О. Д. Беляева, С. Н. Пчелина, Е. А. Баженова, Т. Л. Каронова, Д. А. Колодина, Е. А. Полякова, А. Р. Волкова, С. Н. Козлова, О. А. Беркович, Е. И. Баранова
"... .Objective. To identify the association of genetic variants of ADIPOQ with adiponectin level, AO and MS in women ..."
 
Том 16, № 2 (2017) Синдром Линча. Современное состояние проблемы Аннотация  PDF (Rus)  похожие документы
А. С. Цуканов, Ю. А. Шелыгин, Д. А. Семенов, Д. Ю. Пикунов, А. В. Поляков
"... также рассмотрены вопросы диагностики, хирургических и химиотерапевтических мероприятий у такого рода ..."
 
Том 15, № 2 (2016) Результаты анализа носительства спинальной мышечной атрофии с использованием новой медицинской технологии «Количественный метод детекции числа копий генов локуса СМА» Аннотация  PDF (Rus)  похожие документы
В. В. Забненкова, О. А. Щагина, А. В. Поляков
"... been mapped to chromosome 5q12.2-q13.3. Gene codes for a survival motor neuron protein (SMN). It has ..."
 
Том 15, № 5 (2016) Исследование ассоциации полиморфных вариантов rs1333040 и rs7865618 хромосомы 9p21 с развитием артериовенозных мальформаций Аннотация  PDF (Rus)  похожие документы
С. А. Эркинова, В. С. Киселёв, Н. В. Стрельников, К. Ю. Орлов, А. В. Дубовой, Е. Н. Воронина, М. Л. Филипенко
"... Siberian region. Method: The study included 191 patients (124 men and 67 women) with brain BAVM`s ..."
 
Том 14, № 12 (2015) Аллельный полиморфизм генов, ассоциированных с активностью плазменного звена гемостаза, и риск венозного тромбоэмболизма у лиц молодого возраста Аннотация  PDF (Rus)  похожие документы
А. В. Демьяненко, С. И. Капустин, В. В. Сорока, П. В. Чечулов
"... and fifty patients with VTE - 119 men and 131 women, mean age 37.4 years (from 10 up to 45 years old) were ..."
 
Том 14, № 11 (2015) Сравнение репродуктивных параметров и индекса Кроу сельских карачаевцев и черкесов Аннотация  PDF (Rus)  похожие документы
Г. И. Ельчинова, А. Х. Макаов, Р. А. Зинченко
"... and Chircassians. The data are obtained in the survey of rural women of postreproductive age. Respondents are 1302 ..."
 
Том 14, № 1 (2015) ОПИСАТЕЛЬНАЯ ЭПИДЕМИОЛОГИЯ АТРЕЗИИ ПИЩЕВОДА (ПО ДАННЫМ МОНИТОРИНГА ВПР) Аннотация  PDF (Rus)  похожие документы
Н. С. Демикова, Ю. В. Выдрыч, М. А. Подольная, А. С. Лапина, А. Ю. Асанов
"... was higher for the older maternal age group (RR is 1.51, 95% CI 1.25—1.84); for male (RR 1.22, 95% CI 1 ..."
 
Том 15, № 6 (2016) Роль полиморфных вариантов гена ангиотензин-превращающего фермента (АСЕ) в формировании различных типов ремоделирования миокарда у больных хронической сердечной недостаточностью Аннотация  PDF (Rus)  похожие документы
А. Э. Пушкарева, Р. И. Хусаинова, Р. Р. Валиев, Г. П. Арутюнов, Э. К. Хуснутдинова
"... (LV) remodeling and 194 conditionally healthy men and women of corresponding age, also ..."
 
Том 17, № 11 (2018) Эпигенетическая модификация Х-сцепленных CNV в норме и патологии Аннотация  похожие документы
Е. Н. Толмачёва, А. А. Кашеварова, Л. П. Назаренко, Н. А. Скрябин, Е. А. Фонова, Е. О. Беляева, О. А. Салюкова, Л. И. Минайчева, К. А. Павлова, Л. А. Затула, И. Н. Лебедев
"... : 111 women with miscarriage and 47 women with no history of spontaneous abortions were examined. Using ..."
 
Том 16, № 2 (2017) Ассоциация ОНП Pro12Ala (rs1801282) гена PPARG с уровнем мРНК в интраабдоминальной жировой ткани у женщин Аннотация  PDF (Rus)  похожие документы
А. Э. Копытова, М. А. Николаев, Т. С. Усенко, В. В. Мирошникова, Е. А. Баженова, О. А. Беркович, Е. И. Баранова, Д. Л. Бровин, А. А. Пантелеева, И. А. Семенова, О. Д. Беляева, С. Н. Пчелина
"... adipose tissue in fertile women in Russia. The study included 27 women without type 2 diabetes mellitus ..."
 
Том 14, № 1 (2015) ЭФФЕКТИВНОСТЬ МЕДИКО-ГЕНЕТИЧЕСКОГО ПРОГНОЗИРОВАНИЯ РИСКА ХРОМОСОМНОЙ ПАТОЛОГИИ ПЛОДА ПОСЛЕ ЭКО Аннотация  PDF (Rus)  похожие документы
А. Ш. Латыпов
"... We analyzed the results of prenatal screening in women achieved pregnancy through IVF. There were ..."
 
Том 17, № 11 (2018) Прогностическое значение кариотипа эмбриона и предыдущих исходов беременности при привычном невынашивании Аннотация  похожие документы
Т. В. Никитина, Е. А. Саженова, Е. Н. Толмачева, Н. Н. Суханова, Д. И. Жигалина, Л. И. Минайчева, И. Н. Лебедев
"... and secondary RPL. Of the 563 abortuses karyotyped, 335 were from women with primary and 228 with secondary RPL ..."
 
Том 17, № 5 (2018) Сравнительный анализ цитогенетического исследования и хромосомного микроматричного анализа биологического материала при невынашивании беременности Аннотация  PDF (Rus)  похожие документы
Е. В. Кудрявцева, В. В. Ковалев, Н. Н. Потапов, И. В. Канивец, А. В. Антонец, Ф. А. Коновалов, Д. В. Пьянков, С. А. Коростелев
"... of conception from women with miscarriage. Materials and methods. A comparative analysis of the two diagnostic ..."
 
Том 17, № 5 (2018) Мутации гена CFTR у мужчин с бесплодием Аннотация  PDF (Rus)  похожие документы
Е. В. Соловьева, Д. А. Татару, О. Г. Преда, В. Г. Артюхова, А. Г. Секира, В. Ю. Деревьева, Н. А. Махалова, А. В. Новосельцева, И. В. Рендашкин, Т. А. Зайцева, Н. В. Кеосьян, О. А. Серебренникова
"... приемлемого для ИКСИ качества. Беременности и роды получены у 7 из 8 супружеских пар. ..."
 
Том 15, № 4 (2016) Исследование связи мутации R249Q гена MYH7 с внезапной сердечной смертью Аннотация  PDF (Rus)  похожие документы
А. А. Иванова, В. Н. Максимов, С. В. Савченко, М. И. Воевода
"... for sudden cardiac death (n = 379, mean age 53,2 ± 8,7 years, men - 70.9%, women - 29.1%), the control group ..."
 
Том 16, № 2 (2017) Анализ взаимосвязи полиморфизма A/G (rs1801310) гена GSS с развитием миомы матки: пилотное исследование Аннотация  PDF (Rus)  похожие документы
О. К. Кудрявцева, Е. М. Барышева, М. В. Сорокина, О. Б. Полшведкина, Н. В. Иванова, А. В. Полоников, О. Ю. Бушуева
"... healthy women were enrolled in this study. Genotyping of A/G gene polymorphism was performed through ..."
 
Том 14, № 5 (2015) РОЛЬ ГЕНЕТИЧЕСКИХ МАРКЁРОВ И НУТРИЕНТОВ В РАЗВИТИИ МНОГОФАКТОРНЫХ ЗАБОЛЕВАНИЙ Аннотация  PDF (Rus)  похожие документы
А. Н. Кучер
"... , èíñóëüòîì è ò.ä. [24, 47]. Îäíèì èç íàèáîëåå èçó÷åí- íûõ ãåíåòè÷åñêèõ âàðèàíòîâ ÿâëÿåòñÿ Ñ677Ò â ãåíå MTHFR ..."
 
Том 15, № 9 (2016) Copy numbers of active ribosomal genes in genomes carrying different allelic variants of genes for glutathione S-transferases GSTT1 and GSTM1 Аннотация  PDF (Rus)  похожие документы
Н. А. Ляпунова, Ю. А. Ревазова
"... healthy subjects (13 men and 31 women aged 17 to 65 years). Previously, polymorphisms of the genes ..."
 
Том 17, № 3 (2018) Общность и специфичность генетической компоненты подверженности сахарному диабету первого типа и хроническому вирусному гепатиту С Аннотация  PDF (Rus)  похожие документы
И. А. Гончарова, Н. В. Тарасенко, А. В. Марков, М. С. Назаренко, Е. В. Белобородова, Е. И. Кондратьева, В. П. Пузырев
"... of patients with HCV included 184 persons (71% men and 29% women; mean age 40.2 ± 13.9 years old). The group ..."
 
Том 16, № 3 (2017) Полиморфизм +1675G>A гена AGTR2 ассоциирован с развитием ишемического инсульта Аннотация  PDF (Rus)  похожие документы
Т. А. Стецкая, А. В. Полоников, В. О. Солдатов, А. Е. Бирюков, В. Б. Ласков, В. П. Иванов, О. Ю. Бушуева
"... showed that +1675AA genotype associated with an increased risk of ischemic stroke in women (OR = 2,09; 95 ..."
 
Том 14, № 4 (2015) МАТЕРИАЛЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И МАТЕРИАЛЫ 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... ðåêòàëüíîãî ðàêà àññîöèèðîâàíà ñ ãåðìèíàëüíûìè âàðèàíòàìè ãåíîâ TYMS 2R/2R-2R/3R (rs34743033) è MTHFR 677C/C ..."
 
Том 15, № 4 (2016) Молекулярное кариотипирование при недифференцированных формах интеллектуальных расстройств: от хромосомных мутаций к идентификации патогенетически значимых генов Аннотация  PDF (Rus)  похожие документы
А. А. Кашеварова, Н. А. Скрябин, М. Е. Лопаткина, О. А. Салюкова, М. Н. Филимонова, О. В. Лежнина, А. Р. Шорина, А. Б. Масленников, Л. П. Назаренко, V. . Culic, И. Н. Лебедев
"... .2-p12.2 (OMIM#611913), 22q11.2 (OMIM#188400) è ìèêðîäóï- ëèêàöèè 1q21.1, 17ð13.3 (OMIM#247200), 22q11 ..."
 
Том 16, № 4 (2017) Вклад полиморфизма (rs55754655) гена альдегидоксидазы в развитие острого панкреатита Аннотация  PDF (Rus)  похожие документы
Т. А. Самгина, О. Ю. Бушуева, Ю. В. Канищев, С. Н. Григорьев, П. М. Назаренко, А. В. Полоников
"... that the genotype A / G was associated with development of acute pancreatitis in women (OR = 3.36 95% CI 1.25-9.01 p ..."
 
Том 17, № 1 (2018) Ассоциация гена аполипопротеина Е с вариабельностью когнитивных способностей пожилых людей Аннотация  PDF (Rus)  похожие документы
А. В. Марусин, О. А. Макеева, К. В. Вагайцева, А. В. Бочарова, М. Г. Сваровская, Р. Р. Салахов, В. А. Степанов
"... score. The study was performed on a group of 695 elderly people (177 men and 518 women) tested ..."
 
Том 16, № 2 (2017) Роль полиморфных вариантов генов NO-синтаз и аргиназы при бронхиальной астме у детей Аннотация  PDF (Rus)  похожие документы
Б. Ц. Батожаргалова, Ю. Л. Мизерницкий, С. Э. Дьякова, Н. В. Петрова, Р. А. Зинченко
"... ' R 5'- TGGTAAGAGCCATGTCCAAGC -3' MspI *A — 122 ï.í. *G — 21+201 ï.í. (ÐÕÂ). Äëÿ ñðàâ íå íèÿ ðàñ ..."
 
Том 14, № 5 (2015) ВОЗМОЖНОСТЬ ОЦЕНКИ ЭФФЕКТИВНОСТИ МЕДИКО-ГЕНЕТИЧЕСКОГО КОНСУЛЬТИРОВАНИЯ. ОБЗОР ЛИТЕРАТУРЫ Аннотация  PDF (Rus)  похожие документы
Е. Е. Баранова, Л. Ю. Иванова, И. В. Журавлева, В. Л. Ижевская, Е. К. Гинтер
"... N. et al. Knowledge About Hereditary Cancer of Women with Family Histories of Breast, Colorectal, or ..."
 
Том 13, № 11 (2014) МЕДИКО-ГЕНЕТИЧЕСКОЕ ИЗУЧЕНИЕ НАСЕЛЕНИЯ РЕСПУБЛИКИ ТАТАРСТАН. VII. РАЗНООБРАЗИЕ НАСЛЕДСТВЕННОЙ ПАТОЛОГИИ В ВОСЬМИ РАЙОНАХ Аннотация  PDF (Rus)  похожие документы
Р. А. Зинченко, В. А. Галкина, Е. Л. Дадали, О. В. Хлебникова, Л. К. Михайлова, В. В. Кадышев, С. Г. Гаврилина, А. Н. Петрин, Г. И. Ельчинова, А. В. Поляков, В. В. Стрельников, Д. В. Залетаев, Т. А. Васильева, Н. В. Петрова, Н. Е. Петрина, Е. Ю. Захарова, Л. А. Бессонова, Е. К. Гинтер
"... , ïòîç) 2 2 104633 2 132049 122 *** Ñèíäðîì ãèïîòðèõîçà è òóãîóõîñòè 9 9 23252 9 29344 123 #164200 ..."
 
Том 15, № 3 (2016) Исследование рецессивных форм НМСН у российских больных с использованием новой медицинской технологии «Система детекции в одной пробирке частых мутаций при рецессивных наследственных моторно-сенсорных нейропатиях» Аннотация  PDF (Rus)  похожие документы
О. А. Щагина, Т. Б. Миловидова, М. В. Булах, А. В. Поляков
"... êîìïàóíä-ãåòåðîçèãîòíîì ñîñòîÿíèèå ñ ïÿòîé, Ile41Thr (c.122T>C) [9]. Êàê è äëÿ áîëüøèíñòâà àóòîñîìíî ..."
 
Том 15, № 4 (2016) Репликация данных полногеномных анализов ассоциации атопического дерматита в Республике Башкортостан Аннотация  PDF (Rus)  похожие документы
Г. Ф. Гималова, А. С. Карунас, Ю. Ю. Федорова, Э. Р. Гуменная, С. В. Левашева, Э. И. Эткина, Э. К. Хуснутдинова
"... 122 òàòàðèíà), ïðîæèâàþùèõ â Ðåñïóáëèêå Áàøêîðòîñòàí. Êîíòðîëüíóþ ãðóïïó ñî- ñòàâèëè 187 èíäèâèäîâ ..."
 
Том 14, № 10 (2015) Результаты анкетирования родителей больных фенилкетонурией детей. 3. Отношение к пренатальной диагностике фенилкетонурии Аннотация  PDF (Rus)  похожие документы
В. Л. Ижевская, Л. Ю. Иванова, Е. А. Борзов, И. В. Журавлева, Е. К. Гинтер
"... to support women’s decision making in pre- gnancy and birth: A systematic review and meta-analysis ..."
 
Том 15, № 7 (2016) Случай кампомелической дисплазии у плода 1 триместра: ультразвуковые и морфологические признаки Аннотация  PDF (Rus)  похожие документы
А. А. Лазаревич, И. В. Новикова
"... translucency measurement at weeks 10-13 in 4,233 unselected pregnant women. Prenat Diagn. 1998; 18: 29-34. 8 ..."
 
Том 15, № 2 (2016) ДНК-диагностика атаксии Фридрейха с использованием новой медицинской технологии «Способ поиска экспансии GAA-повтора гена FXN, ответственного за атаксию Фридрейха» Аннотация  PDF (Rus)  похожие документы
Н. М. Галеева, О. Л. Миронович, В. В. Забненкова, О. А. Щагина, А. В. Поляков
"... Diagnostic Tec- hniques in Friedreich’s Ataxia. Annual Review & Research in Biolo- gy. 2013 3(4): 659-677 ..."
 
1 - 50 из 88 результатов 1 2 > >> 

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)