Preview

Медицинская генетика

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
Том 15, № 8 (2016) Оптимизация условий трансфекции клеточной культуры CFTE29o- для разработки редактирования мутации F508del в гене CFTR Аннотация  PDF (Rus)  похожие документы
С. А. Смирнихина, А. В. Банников, А. В. Лавров
"... to optimize genome editing of F508del mutation in CFTR gene. ..."
 
Том 14, № 6 (2015) ИНСТРУМЕНТЫ ГЕНОМНОЙ ИНЖЕНЕРИИ, ПРЕДНАЗНАЧЕННЫЕ ДЛЯ СОЗДАНИЯ ИЗОГЕННОЙ КЛЕТОЧНОЙ МОДЕЛИ БОКОВОГО АМИОТРОФИЧЕСКОГО СКЛЕРОЗА Аннотация  похожие документы
К. Р. Валетдинова, Е. И. Устьянцева, Е. А. Елисафенко, Д. О. Жарков, А. Е. Тупикин, М. Р. Кабилов, С. П. Медведев, С. М. Закиян
"... Genome editing systems TALENs and CRISPR/Cas9 are powerful tools to solve critical problems ..."
 
Том 17, № 10 (2018) Перспективы и ограничения редактирования кариотипа и хромосомной терапии Аннотация  похожие документы
А. А. Кашеварова, О. Л. Серов, И. Н. Лебедев
"... centromere using the CRISPR/Cas9 system. It was shown that the ring chromosome can be created using CRISPR ..."
 
Том 17, № 5 (2018) Терапевтические подходы к использованию системы редактирования генома CRISPR/Cas при наследственных болезнях у человека и модельных животных Аннотация  PDF (Rus)  похожие документы
В. А. Мглинец
"... Since the opening of the CRISPR / Cas genome editing system, this technology has made significant ..."
 
Том 15, № 9 (2016) Генная терапия наследственных заболеваний с использованием технологии CRISPR/Cas9 in vivo Аннотация  PDF (Rus)  похожие документы
С. А. Смирнихина, А. В. Лавров
"... editing technologies using specific nucleases gives us new possibilities in the treatment of various ..."
 
Том 15, № 11 (2016) Проект национального консенсуса «Муковисцидоз: определение, диагностические критерии, терапия» Раздел «Генетика муковисцидоза. Молекулярно-генетическая диагностика при муковисцидозе» Аннотация  PDF (Rus)  похожие документы
Н. В. Петрова, Е. И. Кондратьева, С. А. Красовский, А. В. Поляков, Т. Э. Иващенко, А. Е. Павлов, Р. А. Зинченко, Е. К. Гинтер, С. И. Куцев, О. Н. Одинокова, Л. П. Назаренко, Н. И. Капранов, В. Д. Шерман, Е. Л. Амелина, И. К. Ашерова, Т. Е. Гембицкая, Н. А. Ильенкова, И. П. Каримова, Н. Б. Мерзлова, Л. С. Намазова-Баранова, А. Ф. Неретина, В. С. Никонова, А. В. Орлов, Т. А. Протасова, С. Ю. Семыкин, Д. Ф. Сергиенко, О. И. Симонова, Л. А. Шабалова, Н. Ю. Каширская
"... and international experience in genetic diagnostics of cystic fibrosis, conditions associated with the CFTR . Modern ..."
 
Том 16, № 1 (2017) Фрагментный анализ полиморфизма (TG)mTn интрона 8 гена CFTR Аннотация  PDF (Rus)  похожие документы
Е. В. Маркова, Д. А. Татару, О. Г. Преда
"... transmembrane conductance regulator ( CFTR ) gene is associated with variable efficiency of exon 9 splicing ..."
 
Том 17, № 5 (2018) Мутации гена CFTR у мужчин с бесплодием Аннотация  PDF (Rus)  похожие документы
Е. В. Соловьева, Д. А. Татару, О. Г. Преда, В. Г. Артюхова, А. Г. Секира, В. Ю. Деревьева, Н. А. Махалова, А. В. Новосельцева, И. В. Рендашкин, Т. А. Зайцева, Н. В. Кеосьян, О. А. Серебренникова
"... CFTR mutation analysis is recommended for congenital bilateral aplasia of the vas deferens as well ..."
 
Том 17, № 9 (2018) Применение кишечных органоидов для персонализированной диагностики и терапии муковисцидоза Аннотация  PDF (Rus)  похожие документы
А. С. Ефремова, Т. Б. Бухарова, Н. Ю. Каширская, Д. В. Гольдштейн
"... organoid cultures are utilized as a sensitive screening platform for estimation of CFTR channel functional ..."
 
Том 15, № 2 (2016) Генетическая гетерогенность менделирующих заболеваний и ДНК-диагностика Аннотация  PDF (Rus)  похожие документы
А. В. Поляков, О. А. Щагина
"... диктует необходимость оптимизации процедур ДНК-диагностики. Рассмотрены подходы к оптимизации ДНК ..."
 
Том 18, № 1 (2019) Метод скрининга частых инсерций/делеций в гене АТР7В Аннотация  похожие документы
Г. М. Баязутдинова, О. А. Щагина, А. С. Карунас, А. В. Поляков, Э. К. Хуснутдинова
"... .2532delA, c.3036insC, c.3402delC, c.3627_3642del4, c.3649_3654del6, c.[3942delCA;3947delG] were ..."
 
Том 15, № 9 (2016) Генетические аномалии: влияние на эффективность терапии, выживаемость больных множественной миеломой, роль в оценке минимальной остаточной болезни Аннотация  PDF (Rus)  похожие документы
А. Д. Гарифуллин, С. В. Волошин, И. С. Мартынкевич, Е. В. Клеина, Г. Н. Салогуб, Е. В. Карягина, К. М. Абдулкадыров, А. В. Чечеткин
"... reorganization (t(11;14), t(4;14), etc.), del(13)(q14), del(17)(p13.1), anomalies of 1 chromosome, hypodiploidy ..."
 
Том 16, № 4 (2017) Полиморфизм генов глутатион S-трансфераз и предрасположенность к сахарному диабету 2 типа у жителей Центрального Черноземья Аннотация  PDF (Rus)  похожие документы
Ю. Э. Азарова, А. И. Конопля, А. В. Полоников
"... healthy subjects (mean age 59,49 ± 8,14). Genotyping of deletion (del) polymorphisms of GSTM1 and GSTT1 ..."
 
Том 12, № 4 (2013) АССОЦИАЦИИ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ РЕПАРАЦИИ ДНК И МЕТАБОЛИЗМА КСЕНОБИОТИКОВ С УРОВНЕМ ХРОМОСОМНЫХ НАРУШЕНИЙ В ЛИМФОЦИТАХ ЧЕЛОВЕКА Аннотация  PDF (Rus)  похожие документы
Н. П. Бабушкина, А. Н. Кучер, И. Н. Лебедев, С. А. Васильев, В. А. Тимошевский, Е. Ю. Брагина, Н. Н. Суханова, Н. Б. Торхова, Ю. С. Яковлева
"... of xenobiotics (Cyp2C19 (rs4244285), GSTT1 (del) и GSTM1 (del)) genes in cohort of plutonium workers and control ..."
 
Том 17, № 10 (2018) Клинико-генетические характеристики пациентов с хромосомными перестройками, сопровождающимися судорогами Аннотация  похожие документы
И. А. Акимова, А. О. Боровиков
"... значительную роль при составлении диагностических алгоритмов, направленных на оптимизацию молекулярно ..."
 
Том 15, № 8 (2016) Молекулярная эпидемиология наследственной патологии в десяти популяциях Карачаево-Черкесской Республики Аннотация  PDF (Rus)  похожие документы
А. Х. Макаов, Р. А. Зинченко, О. В. Хлебникова, Л. К. Михайлова, Н. В. Петрова, П. . Гундорова, Н. Е. Петрина, Т. А. Васильева, А. В. Марахонов, Т. А. Адян, А. В. Поляков, Е. К. Гинтер
"... ðóññêîé ñåìüå îïðåäåëåí ãåíîòèï F508del/2184insA. Âûÿâëåíà âûñîêàÿ äîëÿ (93,33%) CFTR ìóòàöèè W1282X ó ..."
 
Том 14, № 12 (2015) Медико-генетическое обследование населения г.Черкесска Карачаево-Черкесской Республики Аннотация  PDF (Rus)  похожие документы
Р. А. Зинченко, А. Х. Макаов, В. А. Галкина, Е. Л. Дадали, О. В. Хлебникова, Л. К. Михайлова, Н. В. Петрова, Н. Е. Петрина, Т. А. Васильева, А. Н. Петрин, В. В. Стрельников, А. В. Поляков, Е. К. Гинтер
"... îïðåäåëåíû ñëåäóþùèå ãåíîòèïû (ãåí CFTR): W1282X/W1282X (n = 2/2) ó êàðà÷àåâöåâ è F508del/2184insA (n = 181 ..."
 
Том 16, № 1 (2017) Влияние однонуклеотидных полиморфизмов генов TNF и LTA на клинические параметры и маркеры воспаления у пациентов с муковисцидозом Аннотация  PDF (Rus)  похожие документы
Г. В. Шмарина, Д. А. Пухальская, А. М. Букина, Л. В. Авакян, С. Ю. Семыкин, Е. Л. Амелина, С. А. Красовский, М. Ю. Усачева, В. А. Алешкин
"... horst M, et al. An unex pec ted ef - fect of TNF-a on F508del-CFTR ma tu ra ti on and fun c ti on. F ..."
 
Том 14, № 3 (2015) ТЕЗИСЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... %. Ðåçóëüòàòû MLPA-àíàëèçà ó ïàöèåíòîâ ÑÌÀ Òèïû ÑÌÀ Êîëè÷å- ñòâî âû- ÿâëåííîé ïàòîëî- ãèè (n) Del 7 ex. SMN1 ..."
 
Том 15, № 3 (2016) Оценка частоты врожденной мышечной дистрофии 1А в РФ с использованием новой медицинской технологии «Система детекции в одной пробирке частых мутаций при врожденных несиндромальных мышечных дистрофиях» Аннотация  PDF (Rus)  похожие документы
Т. Б. Миловидова, О. А. Щагина, А. В. Поляков
"... _2050del2, c.6488delA, c.7536delC, c.7732C>T, c.7750-1713_7899-2153del, c.8007delT ãåíà LAMA2 è c.94_96del3 ..."
 
Том 15, № 10 (2016) Современные подходы к лечению миодистрофий Аннотация  PDF (Rus)  похожие документы
Ю. В. Вяхирева, Н. В. Зернов, А. В. Марахонов, А. А. Гуськова, М. Ю. Скоблов
"... le a ses, TA LE-àñ ñî öè è ðî âàí íûå íóê ëå à çû) è CRISPR/Cas9 (Clus te red, Re gu lar ly In ter ..."
 
Том 15, № 2 (2016) Результаты использования новых медицинских технологий «Детекция основных точковых мутаций гена PAH методом мультиплексной лигазной реакции» и «Детекция десяти дополнительных точковых мутаций гена PAH методом мультиплексной лигазной реакции» в ДНК-диагностике фенилкетонурии Аннотация  PDF (Rus)  похожие документы
П. . Гундорова, А. А. Степанова, О. А. Щагина, А. В. Поляков
"... TAAGTAATTTACACCTTACGAGGCCACTCGAAACTAATTTACTTAAACTTATAATACTATG GATGCGATCCGATGCCTTCATG MLP5DEL F CTCCATGCCAACAGTCGACATC GTT CCAGGAGCTGGAAAGGGTCAT MLP5DEL LINKER ..."
 
Том 15, № 6 (2016) Случай интерстициальной делеции короткого плеча хромосомы 4 у мальчика 13 лет с дефицитом веса и трудностями в обучении Аннотация  PDF (Rus)  похожие документы
В. Г. Антоненко, Т. В. Маркова, Ж. Г. Маркова, Е. В. Мусатова, Ю. О. Козлова, Н. В. Шилова
"... áûëà ðàñ- öåíåíà êàê del(4)(p15.2p16) (ðèñ. 2). Êàðèîòèïû ðîäèòåëåé áûëè íîðìàëüíûìè. Äëÿ óòî÷íåíèÿ ..."
 
Том 15, № 7 (2016) Медико-генетическое консультирование на основе комплексного преконцепционного ДНК-тестирования будущих родителей с целью снижения рисков моногенной патологии детей Аннотация  PDF (Rus)  похожие документы
М. В. Кречмар
"... ¸ ïðîÿâëåíèé. Òàê, óñòàíîâëåííîå ó äîíîðà íîñèòåëüñòâî F508 è äðóãèõ ìóòàöèé â ãåíå CFTR ñ ó÷åòîì âûñîêîé ÷àñ ..."
 
Том 14, № 12 (2015) Аллельный полиморфизм генов, ассоциированных с активностью плазменного звена гемостаза, и риск венозного тромбоэмболизма у лиц молодого возраста Аннотация  PDF (Rus)  похожие документы
А. В. Демьяненко, С. И. Капустин, В. В. Сорока, П. В. Чечулов
"... 1-ãî òèïà (PAI-1 -675 4G/5G), òêàíåâîãî àêòèâàòîðà ïëàçìèíîãåíà (TPA, 311 ï.í. Ins/Del), à òàê- æå ..."
 
Том 16, № 2 (2017) Частота мутаций гена GJB2 у больных наследственной несиндромальной нейросенсорной тугоухостью в девяти популяциях Карачаево-Черкесской Республики Аннотация  PDF (Rus)  похожие документы
Н. Е. Петрина, Е. А. Близнец, Р. А. Зинченко, А. Х. Макаов, Н. В. Петрова, Т. А. Васильева, Л. В. Чудакова, А. Н. Петрин, А. В. Поляков, Е. К. Гинтер
"... (http://www.hgvs.org/mut no men/). ×åò âåð òûé ýòàï — ïî èñê ïðî òÿ æåí íîé äå ëå öèè 309 kb del ..."
 
Том 14, № 2 (2015) ТЕЗИСЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... , ñâÿçàííûå ñ ïðîãðåñ- ñèåé îïóõîëè, del(13q14), del(17p13)/ð53, t(8q24)/c-MYC, dup/amp(1q21) è äð. dup/amp(1q ..."
 
Том 15, № 6 (2016) Изучение взаимосвязи генотипов (РАН) и фенотипов у больных фенилкетонурией Ростовской области Аннотация  PDF (Rus)  похожие документы
М. А. Амелина, Р. А. Зинченко, А. А. Степанова, П. . Гундорова, А. В. Поляков, С. С. Амелина
"... 5DEL (1,92%) R261X (1,20%). Äèàãíîñòèðîâàíû äâå ðàíåå íå îïèñàííûå ìóòàöèè — Y268C (0,38%), c.1298 ..."
 
Том 15, № 7 (2016) Герминальные мутации в генах системы репарации ДНК у пациентов с раком предстательной железы Аннотация  PDF (Rus)  похожие документы
И. Р. Гилязова, Г. Б. Кунсбаева, М. А. Янкина, А. Т. Мустафин, Р. И. Сафиуллин, В. Н. Павлов, Э. К. Хуснутдинова
"... ATM rs3218711 — — 0,007 MD NA — — — chr17 BRCA1 — c.4394_4396 del p.1465_1466 del — M NA — chr13 ..."
 
Том 12, № 1 (2013) МОЛЕКУЛЯРНОЕ КАРИОТИПИРОВАНИЕ (ACGH) КАК СОВРЕМЕННЫЙ ПОДХОД К ИССЛЕДОВАНИЮ ПРИЧИН НЕВЫНАШИВАНИЯ БЕРЕМЕННОСТИ Аннотация  PDF (Rus)  похожие документы
Т. В. Никитина, А. А. Кашеварова, Н. А. Скрябин, Н. Н. Чечеткина, И. Н. Лебедев, А. А. Мельников
"... 20 BAC, Ge no Sen sor Ar ray 300 del9p21, dup15q11-q13, dup10qtel 3 (7%) Ben k ha li fa et al ..."
 
Том 14, № 4 (2015) МАТЕРИАЛЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И МАТЕРИАЛЫ 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... íîíñåíñ ìóòàöèè c.183C>A (p.Tyr61X), c.732C>A (p.Tyr244X) è äâå äåëå- öèè p.Ile158_Pro161del (c.474_485del ..."
 
Том 15, № 6 (2016) Изучение генетических основ и разработка протоколов для диагностики наследственных заболеваний органа зрения на примере врожденной аниридии Аннотация  PDF (Rus)  похожие документы
Т. А. Васильева, О. В. Хлебникова, А. В. Марахонов, Н. В. Петрова, А. А. Воскресенская, Н. А. Поздеева, И. А. Крынская, Ю. О. Козлова, Н. В. Ряднинская, А. Л. Чухрова, Н. В. Шилова, Р. А. Зинченко
"... _294dup4(CTTT), c.449_453del5(ACGGG)ins7(CCGGAAC), c.760delA, c.879delC, c.1047_1050del4(CCAG)), îäíà ..."
 
Том 15, № 10 (2016) Гены BRCA1 и BRCA2: популяционные особенности развития рака молочной железы у татарских женщин Аннотация  PDF (Rus)  похожие документы
О. И. Бровкина, М. Г. Гордиев, Л. Х. Шигапова, М. О. Дружков, Е. И. Шагимарданова, Р. Ф. Еникеев, Д. С. Ходырев, О. А. Гусев, А. Г. Никитин
"... .Cys61Gly 2 BRCA2 chr13:32907409 NM_000059.3:c.1796_1800del p.Ser599* 1 BRCA2 chr13:32968950 NM_000059 ..."
 
Том 15, № 9 (2016) Разработка таргетной панели для молекулярно-генетической диагностики рака щитовидной железы Аннотация  PDF (Rus)  похожие документы
В. Д. Якушина, М. А. Зайцева, А. Е. Павлов, Л. В. Лернер, А. В. Лавров
"... àíàëèçà ëè- òåðàòóðû áûëè âûáðàíû 3 CNV, õàðàêòåðíûå äëÿ ÐÙÆ: SCNA-22q-del, 9q21.3-q32 del, 1q gain [3 ..."
 
Том 15, № 10 (2016) Влияние генов первой фазы биотрансформации ксенобиотиков на течение муковисцидоза и ответ при проведении антибактериальной терапии Аннотация  PDF (Rus)  похожие документы
Н. В. Петрова, О. Г. Новоселова, Е. И. Кондратьева, Р. А. Биканов, Р. А. Зинченко, В. Д. Шерман
"... - íîå ìó òà öèåé ãå íà òðàíñ ìåì á ðàí íî ãî ðå ãó ëÿ òî ðà ìó êî - âèñ öè äî çà (CFTR) è õà ðàê òå ðè ..."
 
Том 15, № 5 (2016) Вариабельность генетического дисбаланса по хромосоме 1 в некультивированных клетках миом матки Аннотация  PDF (Rus)  похожие документы
А. С. Кольцова, О. В. Малышева, А. А. Пендина, О. А. Ефимова, А. Н. Каминская, Н. С. Осиновская, И. Ю. Султанов, Н. Ю. Швед, А. В. Тихонов, В. С. Баранов
"... äåëåöèÿ õðîìîñîìû 7 del(7)(q22q32) èëè ìóòàöèè ãåíà MED12, èíèöèèðóþ- ùèõ òðàíñôîðìàöèþ ìèîöèòà â ..."
 
Том 15, № 5 (2016) Исследование ассоциации полиморфных вариантов rs1333040 и rs7865618 хромосомы 9p21 с развитием артериовенозных мальформаций Аннотация  PDF (Rus)  похожие документы
С. А. Эркинова, В. С. Киселёв, Н. В. Стрельников, К. Ю. Орлов, А. В. Дубовой, Е. Н. Воронина, М. Л. Филипенко
"... . Cerebrovasc Dis. 2014;37(4):290-5 10. Rangel-Castilla L, Russin JJ, Martinez-Del-Campo E et al. Molecular and ..."
 
Том 15, № 8 (2016) Спектр мутаций в гене MYBPC3 у пациентов с гипертрофической кардиомиопатией Аннотация  PDF (Rus)  похожие документы
М. Е. Поляк, А. Б. Ховалыг, А. А. Букаева, С. Л. Дземешкевич, Е. В. Заклязьминская
"... _1630delGAinsAG 1 2. c.2781_2782insCACA 1 3. p.Q1233X 5 4. p.R943X 1 5. p.N515del 1 6. p.S217G 1 Èç ..."
 
Том 16, № 1 (2017) Исследование однонуклеотидных полиморфизмов генов ABC-транспортеров в опухоли молочной железы: связь с экспрессией Аннотация  PDF (Rus)  похожие документы
М. М. Цыганов, М. К. Ибрагимова, И. В. Дерюшева, Н. В. Литвяков
"... - vant Che mot he ra py in Car ci no ma of the Bre ast, Ap ril 26—28, 2003, Phi la del p hia, Pen nsyl ..."
 
Том 15, № 3 (2016) Семейная средиземноморская лихорадка: современные представления Аннотация  PDF (Rus)  похожие документы
С. А. Атоян
"... Ýêçîí 5 F479L Ýêçîí 10 M680I (G/C) M680I (G/A) V726A I692del M694V M694I A744S R761H K695R ..."
 
Том 14, № 11 (2015) Клинико-генетические характеристики синдрома Фелан-МакДермид Аннотация  PDF (Rus)  похожие документы
Е. Л. Дадали, И. В. Канивец, И. В. Шаркова
"... ÷à õðîìîñîìû 22q13: 46,ÕÕ,del(22)(q13). Ãðàíèöû äåëåöèè óòî÷íåíû â ðåçóëüòàòå õðîìîñîìíîãî ìèêðî ..."
 
Том 14, № 11 (2015) Делеции атипичного размера у пациентов с СД22q11.2: клинические проявления и диагностика Аннотация  PDF (Rus)  похожие документы
Ю. О. Козлова, В. В. Забненкова, В. Г. Антоненко, Н. В. Шилова
"... ., Furutani Y., Hamada H. et al. Role of TBX1 in hu- man del22q11.2 syndrome // Lancet. — 2003. — Vol. 25, 362 ..."
 
Том 15, № 3 (2016) Результаты ДНК-диагностики наследственной нейропатии с подверженностью параличам от сдавления с использованием новой медицинской технологии «Способ детекции числа копий гена PMP22» Аннотация  PDF (Rus)  похожие документы
М. В. Булах, О. А. Щагина, Т. Б. Миловидова, А. В. Поляков
"... . Hum. Genet. 1996; (4):25-33. 7. Del Colle R, Fabrizi GM, Turazzini M, et al, Hereditary neu- ropathy ..."
 
Том 15, № 8 (2016) Результаты использования медицинской технологии определения микроделеции 22q11.2 методом микросателлитного анализа у больных c диагнозом вело-кардио-фациальный синдром / ДиДжорджи синдром Аннотация  PDF (Rus)  похожие документы
М. В. Немцова, В. В. Стрельников, Е. Б. Кузнецова, В. В. Руденко, С. А. Казакова, Д. В. Залетаев
"... human del22q11.2 syndrome. Lancet. 2003;362(9393):1366-1373. 11. Vitelli F., Morishima M., Taddei I ..."
 
Том 12, № 4 (2013) ВАРИАБЕЛЬНОСТЬ ГЕНОВ ИНТЕРЛЕЙКИНА 4 И ЕГО РЕЦЕПТОРА В ПОПУЛЯЦИЯХ КОРЕННЫХ НАРОДОВ СИБИРИ Аннотация  PDF (Rus)  похожие документы
В. А. Степанов, Е. А. Трифонова, К. В. Симонова, А. А. Чередниченко
"... EPIC-He i del berg // Clin. Exp. Al ler gy. — 2004. — Vol. 34, ¹3. — P. 346—353. 14. Sa be ti P ..."
 
Том 12, № 2 (2013) ГЕНЕТИЧЕСКИЕ НАРУШЕНИЯ ВЕСТИБУЛЯРНОЙ СИСТЕМЫ Аннотация  PDF (Rus)  похожие документы
В. А. Мглинец
"... ñèè ãå íîâ Ngn1 (ne u ro - ge nin 1) è Dl1 (Del ta 1) ñî îò âåò ñò âó åò ïðî ñïåê òèâ íîé íåé - ðà ..."
 
Том 12, № 2 (2013) ЧАСТОТА ВСТРЕЧАЕМОСТИ ГАМЕТ С АНЕУПЛОИДИЕЙ У МУЖЧИН С НАРУШЕНИЕМ РЕПРОДУКТИВНОЙ ФУНКЦИИ И ПАТОЗООСПЕРМИЕЙ Аннотация  PDF (Rus)  похожие документы
Е. Г. Гордеева, Т. М. Сорокина, Л. В. Шилейко, Т. В. Остроумова, О. С. Борзова, Х. Д. Магомедова, Н. Ю. Кузина, О. В. Баркова, Л. Ф. Курило
"... ,3 0,26 0,17 0,08 0,3 0,67 2 AT, 30 ëåò, ÷à ñ òè÷ íàÿ äå ëå öèÿ â ñóá ðå ãè î íå AZFc (del sY ..."
 
Том 15, № 2 (2016) Оценка частоты поясно-конечностной мышечной дистрофии типа 2L в Российской Федерации Аннотация  PDF (Rus)  похожие документы
М. В. Булах, О. П. Рыжкова, Е. Л. Дадали, Г. Е. Руденская, А. В. Поляков
"... perspecti- ve. Gene. 2006; 376: 207-215. 11. Francesca Magri, Roberto Del Bo, Maria Grazia D’Angelo, Monica ..."
 
Том 14, № 5 (2015) ПРИМЕНЕНИЕ МЕТОДА МИКРОМАТРИЧНОЙ СРАВНИТЕЛЬНОЙ ГЕНОМНОЙ ГИБРИДИЗАЦИИ В ПРЕНАТАЛЬНОЙ ДИАГНОСТИКЕ Аннотация  PDF (Rus)  похожие документы
Н. А. Каретникова, А. Н. Екимов, Е. Е. Баранова, В. А. Бахарев, Д. Ю. Трофимов, А. И. Гус
"... - del-based approach for inferring selection to climate // BMC Gene- tics. — 2013. — Vol. 14. — P. 87 ..."
 
Том 16, № 1 (2017) Анализ генов цитокиновой сети в развитии «обратной» коморбидности для бронхиальной астмы и туберкулеза Аннотация  PDF (Rus)  похожие документы
Е. Ю. Брагина, М. Б. Фрейдин, Н. П. Бабушкина, А. Ф. Гараева, О. В. Колоколова, И. Ж. Жалсанова, В. П. Пузырев
"... . 27. Lo we PR, Gal ley HF, Ab del-Fat tah A et al. In f lu en ce of in - ter le u kin-10 po ly mor p ..."
 
1 - 50 из 56 результатов 1 2 > >> 

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)