Preview

Медицинская генетика

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
Том 18, № 1 (2019) Метод скрининга частых инсерций/делеций в гене АТР7В Аннотация  похожие документы
Г. М. Баязутдинова, О. А. Щагина, А. С. Карунас, А. В. Поляков, Э. К. Хуснутдинова
"... variants, insertion/deletion. The results of study of allelic frequencies of insertion/deletion in ATP7B ..."
 
Том 12, № 3 (2013) СВОЕОБРАЗИЕ ГЕНОФОНДА РУССКОГО И УКРАИНСКОГО НАСЕЛЕНИЯ БЕЛГОРОДСКОЙ ОБЛАСТИ (ПО ДАННЫМ О ПОЛИМОРФИЗМЕ ШЕСТИ ALU-ИНСЕРЦИЙ) Аннотация  PDF (Rus)  похожие документы
И. Н. Лепендина, И. Н. Сорокина, Н. А. Рудых, Е. В. Балановская, М. И. Чурносов
"... data on 6 polymorphic insertions Alu-repeats (A25, TPA25, F13B, PV92, APOA1, B65). Set wide variability ..."
 
Том 17, № 2 (2018) Интерхромосомная и интрахромосомная инсерции с участием хромосомы 2 Аннотация  PDF (Rus)  похожие документы
М. Е. Миньженкова, Ж. Г. Маркова, Е. Л. Дадали, Н. В. Шилова
"... were derived from fathers having a balanced insertion. In case 1 patient was referred for evaluation ..."
 
Том 17, № 6 (2018) Технология комплексной ДНК-диагностики синдрома ломкой Х-хромосомы Аннотация  PDF (Rus)  похожие документы
Е. Б. Кузнецова, В. В. Стрельников, А. С. Танас, М. В. Немцова, Д. В. Залетаев
"... for point mutations and short insertions / deletions in the FMR1 and FMR1-AS1 genes was performed using ..."
 
Том 17, № 9 (2018) Распространенность 27-п.н. делеции гена множественной лекарственной устойчивости ABCC11 Аннотация  похожие документы
С. В. Макаров, М. К. Карапетян, Л. С. Бычковская, В. А. Спицын
"... Proteins of the ATP-binding cassette superfamily have important biological functions for active ..."
 
Том 15, № 11 (2016) Результаты использования новой медицинской технологии комплексной ДНК-диагностики нейрофиброматоза Аннотация  PDF (Rus)  похожие документы
М. С. Чаплыгина, Е. Б. Кузнецова, А. С. Танас, Л. А. Бессонова, Г. Н. Матющенко, В. А. Галкина, М. С. Петухова, И. В. Анисимова, Н. А. Демина, Д. В. Залетаев, В. В. Стрельников
"... insertions / deletions / duplications in NF1 and NF2 genes was carried out with next generation sequencing ..."
 
Том 14, № 10 (2015) Определение функциональной значимости варианта c.423-6A>G в гене APC у пациента с клиническими признаками семейного аденоматоза толстой кишки Аннотация  PDF (Rus)  похожие документы
А. С. Цуканов, Н. И. Поспехова, В. П. Шубин, А. М. Кузьминов, И. Ю. Сачков, В. Н. Кашников, С. А. Фролов, Ю. А. Шелыгин
"... deletions/insertions and nonsence mutations, while other 15% are large deletions, missence and splice site ..."
 
Том 14, № 11 (2015) Делеции атипичного размера у пациентов с СД22q11.2: клинические проявления и диагностика Аннотация  PDF (Rus)  похожие документы
Ю. О. Козлова, В. В. Забненкова, В. Г. Антоненко, Н. В. Шилова
"... исследователей к клинической характеристике пациентов, а также молекулярно-генетическим основам синдрома делеции ..."
 
Том 17, № 7 (2018) ДНК-ДИАГНОСТИКА НАСЛЕДСТВЕННОГО АНГИОНЕВРОТИЧЕСКОГО ОТЕКА И КЛИНИЧЕСКОЕ ЗНАЧЕНИЕ ВАРИАНТОВ ГЕНА SERPING1 Аннотация  похожие документы
Е. А. Близнец, Н. В. Ряднинская, Н. М. Галеева, И. А. Кузнецова, А. В. Дмитриева, Т. В. Латышева, Е. А. Латышева, М. Н. Гусева, А. В. Поляков
"... mutations and nonsence-mutations are often observed,  insertions, large deletions and indels is rarer ..."
 
Том 15, № 6 (2016) Случай интерстициальной делеции короткого плеча хромосомы 4 у мальчика 13 лет с дефицитом веса и трудностями в обучении Аннотация  PDF (Rus)  похожие документы
В. Г. Антоненко, Т. В. Маркова, Ж. Г. Маркова, Е. В. Мусатова, Ю. О. Козлова, Н. В. Шилова
"... Представлен редкий случай интерстициальной делеции короткого плеча хромосомы 4(р15.1-р15.32), не ..."
 
Том 16, № 1 (2017) Исследование однонуклеотидных полиморфизмов генов ABC-транспортеров в опухоли молочной железы: связь с экспрессией Аннотация  PDF (Rus)  похожие документы
М. М. Цыганов, М. К. Ибрагимова, И. В. Дерюшева, Н. В. Литвяков
"... Our previous research establishes that changes of expression of the ATP-binding cassette genes ..."
 
Том 15, № 12 (2016) Молекулярная патология хромосомного района 10q23.3-26.3 при глиобластоме Аннотация  PDF (Rus)  похожие документы
Е. А. Алексеева, А. С. Танас, Е. В. Прозоренко, А. М. Зайцев, М. И. Куржупов, О. Н. Кирсанова, В. В. Руденко, Д. В. Залетаев, В. В. Стрельников
"... является отражением делеции, а в 25% случаев - отражением однородительской дисомии. В 37,5% опухолей ..."
 
Том 17, № 6 (2018) Результаты использования новой медицинской технологии комплексной ДНК-диагностики синдрома Сотоса Аннотация  PDF (Rus)  похожие документы
И. В. Володин, А. С. Танас, Е. Б. Кузнецова, О. А. Симонова, Г. Н. Матющенко, Н. А. Дёмина, М. С. Петухова, Л. А. Бессонова, И. В. Анисимова, М. С. Пащенко, Д. В. Залетаев, В. В. Стрельников
"... мультиплексной амплификации лигированных зондов (MLPA). Поиск точковых мутаций и коротких инсерций/делеций в ..."
 
Том 15, № 8 (2016) Оптимизация условий трансфекции клеточной культуры CFTE29o- для разработки редактирования мутации F508del в гене CFTR Аннотация  PDF (Rus)  похожие документы
С. А. Смирнихина, А. В. Банников, А. В. Лавров
"... into human tracheal epithelial cells CFTE29o- with homozygous F508del mutation. Efficiency of lipofection ..."
 
Том 15, № 7 (2016) Клиническая ценность секвенирования гена ATP7B в диагностике болезни Вильсона-Коновалова Аннотация  PDF (Rus)  похожие документы
М. С. Балашова, О. В. Соловьева, С. В. Фастовец, И. Г. Тулузановская, М. И. Филимонов, Г. М. Баязутдинова, Н. А. Жученко, Т. М. Игнатова, А. Ю. Асанов
"... Wilson disease (WD) is an autosomal recessive copper accumulation disorder. ATP7B gene codes ..."
 
Том 16, № 1 (2017) Молекулярно-генетическая изменчивость в гене ABCC11, кодирующем ATФ-связанный кассетный транспортный белок Аннотация  PDF (Rus)  похожие документы
В. А. Спицын, С. В. Макаров, М. К. Карапетян, Л. С. Бычковская, Н. В. Балинова, Н. В. Алексеева, Л. В. Бец, А. Ю. Асанов, Н. Х. Спицына
"... groups of Russia. The protein encoded by ABCC11 gene is a member of the superfamily of ATP-binding ..."
 
Том 18, № 1 (2019) Синдром протяженной делеции при тяжелой форме мукополисахаридоза II типа Аннотация  похожие документы
Н. А. Полякова, Е. Ю. Воскобоева, И. В. Канивец, С. А. Коростелев, В. С. Какаулина, Н. Л. Печатникова
"... результате протяженной делеции Х хромосомы на примере мукополисахаридоза II типа и умственной отсталости ..."
 
Том 17, № 4 (2018) Мутация с.3207C>A гена ATP7B - наиболее частая причина гепатолентикулярной дегенерации в России: частота и причина распространения Аннотация  PDF (Rus)  похожие документы
Г. М. Баязутдинова, О. А. Щагина, А. В. Поляков
 
Том 15, № 8 (2016) Результаты использования медицинской технологии определения микроделеции 22q11.2 методом микросателлитного анализа у больных c диагнозом вело-кардио-фациальный синдром / ДиДжорджи синдром Аннотация  PDF (Rus)  похожие документы
М. В. Немцова, В. В. Стрельников, Е. Б. Кузнецова, В. В. Руденко, С. А. Казакова, Д. В. Залетаев
"... медицинской технологии, представляющей собой эффективный экспресс-метод выявления делеций хромосомы 22 ..."
 
Том 15, № 9 (2016) Разработка таргетной панели для молекулярно-генетической диагностики рака щитовидной железы Аннотация  PDF (Rus)  похожие документы
В. Д. Якушина, М. А. Зайцева, А. Е. Павлов, Л. В. Лернер, А. В. Лавров
"... variations, CNV), характерные для РЩЖ. Для детекции точковых мутаций, коротких инсерций/делеций и CNV в ..."
 
Том 17, № 8 (2018) Медицинская технология комплексной ДНК-диагностики туберозного склероза Аннотация  похожие документы
К. И. Аношкин, К. О. Карандашева, А. С. Танас, Л. А. Бессонова, Н. А. Демина, М. С. Петухова, И. В. Анисимова, Д. В. Залетаев, В. В. Стрельников
"... . Поиск точковых мутаций, а также малых делеций/инсерций в генах TSC1 и TSC2 осуществляли методом ВПС на ..."
 
Том 17, № 11 (2018) Делеция импринтированного региона 14q32.2 у пациента с синдромом Кагами-Огата Аннотация  похожие документы
Н. А. Семенова, И. В. Анисимова, И. В. Володин, А. В. Ступина, А. Т. Абдраисова, И. Б. Цокова, С. А. Башарин
"... повреждений: однородительская дисомия, делеции и эпимутации. Большинство описанных делеций включают один или ..."
 
Том 16, № 5 (2017) Случай генетического дисбаланса по коротким плечам хромосом 8 и 18 у пациентки без выраженных аномалий физического и умственного развития Аннотация  PDF (Rus)  похожие документы
А. А. Пендина, О. А. Ефимова, О. Г. Чиряева, О. В. Малышева, В. С. Дудкина, Л. И. Петрова, П. А. Павлова, А. В. Тихонов, М. И. Крапивин, А. С. Кольцова, С. Е. Парфеньев, Е. А. Серебрякова, Е. С. Шабанова
"... Представлен редкий случай генетического дисбаланса - терминальных делеций, сочетанных с ..."
 
Том 17, № 12 (2018) MLPA-анализ генов ССМ у больных с различными формами кавернозных мальформаций ЦНС в российской популяции Аннотация  похожие документы
Е. С. Булыгина, О. Б. Белоусова, С. В. Цыганкова, Д. Н. Окишев, А. В. Недолужко, Е. Б. Прохорчук, К. Г. Скрябин, А. Н. Коновалов
"... deletions/insertions and exon sequencing - to search for mutations leading to amino acid substitutions ..."
 
Том 15, № 8 (2016) Делеция экзона 50 гена COL1А2 у плода второго триместра с несовершенным остеогенезом 2 типа Аннотация  PDF (Rus)  похожие документы
И. В. Новикова, Н. А. Венчикова, И. В. Соловьева, А. А. Гусина
"... исследовании выявлена делеция экзона 50 гена COL1А2 . ..."
 
Том 14, № 11 (2015) Клинико-генетические характеристики синдрома Фелан-МакДермид Аннотация  PDF (Rus)  похожие документы
Е. Л. Дадали, И. В. Канивец, И. В. Шаркова
"... , обусловленным делециями хромосомы 22q13, выявленными методами стандартного кариотипирования и хромосомного ..."
 
Том 15, № 9 (2016) Генетические аномалии: влияние на эффективность терапии, выживаемость больных множественной миеломой, роль в оценке минимальной остаточной болезни Аннотация  PDF (Rus)  похожие документы
А. Д. Гарифуллин, С. В. Волошин, И. С. Мартынкевич, Е. В. Клеина, Г. Н. Салогуб, Е. В. Карягина, К. М. Абдулкадыров, А. В. Чечеткин
"... reorganization (t(11;14), t(4;14), etc.), del(13)(q14), del(17)(p13.1), anomalies of 1 chromosome, hypodiploidy ..."
 
Том 15, № 3 (2016) Результаты ДНК-диагностики наследственной нейропатии с подверженностью параличам от сдавления с использованием новой медицинской технологии «Способ детекции числа копий гена PMP22» Аннотация  PDF (Rus)  похожие документы
М. В. Булах, О. А. Щагина, Т. Б. Миловидова, А. В. Поляков
"... делеция гена, на долю которой приходится не менее 70% случаев ННПС. Разработана и внедрена в практическую ..."
 
Том 16, № 4 (2017) Полиморфизм генов глутатион S-трансфераз и предрасположенность к сахарному диабету 2 типа у жителей Центрального Черноземья Аннотация  PDF (Rus)  похожие документы
Ю. Э. Азарова, А. И. Конопля, А. В. Полоников
"... healthy subjects (mean age 59,49 ± 8,14). Genotyping of deletion (del) polymorphisms of GSTM1 and GSTT1 ..."
 
Том 12, № 4 (2013) АССОЦИАЦИИ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ РЕПАРАЦИИ ДНК И МЕТАБОЛИЗМА КСЕНОБИОТИКОВ С УРОВНЕМ ХРОМОСОМНЫХ НАРУШЕНИЙ В ЛИМФОЦИТАХ ЧЕЛОВЕКА Аннотация  PDF (Rus)  похожие документы
Н. П. Бабушкина, А. Н. Кучер, И. Н. Лебедев, С. А. Васильев, В. А. Тимошевский, Е. Ю. Брагина, Н. Н. Суханова, Н. Б. Торхова, Ю. С. Яковлева
"... of xenobiotics (Cyp2C19 (rs4244285), GSTT1 (del) и GSTM1 (del)) genes in cohort of plutonium workers and control ..."
 
Том 15, № 6 (2016) Изучение генетических основ и разработка протоколов для диагностики наследственных заболеваний органа зрения на примере врожденной аниридии Аннотация  PDF (Rus)  похожие документы
Т. А. Васильева, О. В. Хлебникова, А. В. Марахонов, Н. В. Петрова, А. А. Воскресенская, Н. А. Поздеева, И. А. Крынская, Ю. О. Козлова, Н. В. Ряднинская, А. Л. Чухрова, Н. В. Шилова, Р. А. Зинченко
"... аниридии. У двух пациентов определена протяженная делеция региона 11p13, позволившая установить ..."
 
Том 15, № 5 (2016) Вариабельность генетического дисбаланса по хромосоме 1 в некультивированных клетках миом матки Аннотация  PDF (Rus)  похожие документы
А. С. Кольцова, О. В. Малышева, А. А. Пендина, О. А. Ефимова, А. Н. Каминская, Н. С. Осиновская, И. Ю. Султанов, Н. Ю. Швед, А. В. Тихонов, В. С. Баранов
"... , включающий делеции и дупликации, сходен между разными опухолями, однако представленность субпопуляций клеток ..."
 
Том 12, № 4 (2013) ГЕНЕТИЧЕСКИЕ ОСНОВЫ ГЕМИПЛЕГИЧЕСКОЙ МИГРЕНИ Аннотация  PDF (Rus)  похожие документы
Ю. Э. Азимова, Е. А. Климов, К. В. Скоробогатых, А. В. Сергеев, З. Г. Кокаева, Г. Р. Табеева
"... òðàíñ ïîð òå ðû ãå íîâ CACNA1A, ATP1A2 è SCN1A, ÷òî îò ðà æà åò ãå íå òè ÷å ñêóþ ãå òå ðî ãåí íîñòü ..."
 
Том 17, № 6 (2018) Аномалии хромосом 5, 7, 11 и 17 в комплексном кариотипе при миелодиспластических синдромах и острых миелоидных лейкозах Аннотация  PDF (Rus)  похожие документы
Л. А. Гребенюк, Т. Н. Обухова, Е. Н. Паровичникова, Г. А. Алимова, Л. А. Шишигина, В. В. Троицкая, А. В. Кохно, В. Г. Савченко
"... транслокации (38,4%), делеции (65,3%), дополнительный хромосомный материал неизвестного происхождения (69 ..."
 
Том 14, № 2 (2015) ТЕЗИСЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... , ñâÿçàííûå ñ ïðîãðåñ- ñèåé îïóõîëè, del(13q14), del(17p13)/ð53, t(8q24)/c-MYC, dup/amp(1q21) è äð. dup/amp(1q ..."
 
Том 15, № 2 (2016) Результаты анализа носительства спинальной мышечной атрофии с использованием новой медицинской технологии «Количественный метод детекции числа копий генов локуса СМА» Аннотация  PDF (Rus)  похожие документы
В. В. Забненкова, О. А. Щагина, А. В. Поляков
"... проба-зависимой лигазной реакции с последующей амплификацией. Проведена диагностика носительства делеции ..."
 
Том 17, № 4 (2018) Синдром Данона: совокупный анализ данных таргетного NGS и клиники (первый опыт диагностики в Беларуси) Аннотация  PDF (Rus)  похожие документы
Л. Н. Сивицкая, Т. Г. Вайханская, Н. Г. Даниленко, О. Д. Левданский, Т. В. Курушко, О. Г. Давыденко
"... была выявлена делеция с.864+3_864+6delGAGT (rs397516751) в гене LAMP2 , затрагивающая донорный сайт ..."
 
Том 16, № 4 (2017) К вопросу о преконцепционной профилактике наследственных болезней: случай выявления носительства редкой мутации у донора яйцеклеток и реципиентов Аннотация  PDF (Rus)  похожие документы
О. А. Щагина, А. В. Поляков
"... », внедренной в практику ФГБНУ МГНЦ. Установлено, что аллельная частота данной делеции составляет 0 ..."
 
Том 17, № 10 (2018) Мозаичные несбалансированные транслокации de novo: диагностика двух клинических случаев и обзор литературы Аннотация  похожие документы
М. Е. Миньженкова, Ж. Г. Маркова, Н. Ю. Кузина, М. С. Петухова, Г. Н. Матющенко, Н. В. Шилова
"... нормальный кариотип. Хромосомный микроматричный анализ выявил делецию участка короткого плеча хромосомы 8 и ..."
 
Том 13, № 11 (2014) МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ АСПЕКТЫ ЯЗВЕННОЙ БОЛЕЗНИ Аннотация  PDF (Rus)  похожие документы
Э. Х. Шаймарданова, А. Х. Нургалиева, Д. Д. Надыршина, Э. К. Хуснутдинова
"... gastric cancer in Costa Rica // Official J. of the Instituto Mexicano del Ser- gio Social. — 2013. — Vol ..."
 
Том 15, № 5 (2016) Вариации числа копий гена ERLIN1 у больных с ишемической болезнью сердца Аннотация  PDF (Rus)  похожие документы
А. А. Слепцов, М. С. Назаренко, О. Л. Барбараш, В. П. Пузырев
"... индивидов обнаружена делеция анализируемого региона. Кроме того, у двух пациентов данная амплификация ..."
 
Том 17, № 10 (2018) Интерпретация клинически значимых вариаций числа копий ДНК Аннотация  похожие документы
Н. В. Шилова, М. Е. Миньженкова
"... методом выявления клинически значимых CNVs в виде делеций или дупликаций (трипликаций), однако не может ..."
 
Том 17, № 11 (2018) Молекулярно-генетический анализ 617 российских пациентов с клиническим диагнозом «нейрофиброматоз»: новые патогенные и редкие непатогенные генетические варианты Аннотация  похожие документы
М. С. Пащенко, К. О. Карандашева, Е. Б. Кузнецова, И. В. Анисимова, Л. А. Бессонова, В. А. Галкина, Д. М. Гусева, Н. А. Демина, О. Н. Макиенко, Т. В. Маркова, Г. Н. Матющенко, М. С. Петухова, Н. А. Семенова, А. С. Танас, Д. В. Залетаев, В. В. Стрельников
"... осуществляли секвенированием по Сэнгеру, поиск протяженных делеций генов NF1 и NF2 - методом MLPA. Результаты ..."
 
Том 15, № 3 (2016) Оценка частоты врожденной мышечной дистрофии 1А в РФ с использованием новой медицинской технологии «Система детекции в одной пробирке частых мутаций при врожденных несиндромальных мышечных дистрофиях» Аннотация  PDF (Rus)  похожие документы
Т. Б. Миловидова, О. А. Щагина, А. В. Поляков
"... _2050del2, c.6488delA, c.7536delC, c.7732C>T, c.7750-1713_7899-2153del, c.8007delT ãåíà LAMA2 è c.94_96del3 ..."
 
Том 17, № 10 (2018) Клиническая и генетическая характеристика пациентов с недифференцированными формами нарушений интеллектуального развития и хромосомными микродупликациями Аннотация  похожие документы
Е. О. Беляева, Л. П. Назаренко, И. Н. Лебедев
"... идентифицировано 14 делеций и 25 дупликаций, что в общей группе пациентов составило соответственно 7% и 12,5%. 18 ..."
 
Том 15, № 2 (2016) Результаты использования новых медицинских технологий «Детекция основных точковых мутаций гена PAH методом мультиплексной лигазной реакции» и «Детекция десяти дополнительных точковых мутаций гена PAH методом мультиплексной лигазной реакции» в ДНК-диагностике фенилкетонурии Аннотация  PDF (Rus)  похожие документы
П. . Гундорова, А. А. Степанова, О. А. Щагина, А. В. Поляков
"... TAAGTAATTTACACCTTACGAGGCCACTCGAAACTAATTTACTTAAACTTATAATACTATG GATGCGATCCGATGCCTTCATG MLP5DEL F CTCCATGCCAACAGTCGACATC GTT CCAGGAGCTGGAAAGGGTCAT MLP5DEL LINKER ..."
 
Том 15, № 4 (2016) Генетический портрет первичной лекарственной устойчивости различных морфологических структур рака молочной железы Аннотация  PDF (Rus)  похожие документы
Т. С. Геращенко, Е. В. Денисов, М. В. Завьялова, Н. В. Литвяков, С. В. Вторушин, Д. Н. Паутова, Н. В. Крахмаль, Н. А. Скрябин, А. А. Слепцов, Н. В. Чердынцева, В. М. Перельмутер
"... contribution of ATP-binding cassette transporters to drug resistance in cancer che- motherapy and prediction of ..."
 
Том 15, № 6 (2016) Роль полиморфных вариантов гена ангиотензин-превращающего фермента (АСЕ) в формировании различных типов ремоделирования миокарда у больных хронической сердечной недостаточностью Аннотация  PDF (Rus)  похожие документы
А. Э. Пушкарева, Р. И. Хусаинова, Р. Р. Валиев, Г. П. Арутюнов, Э. К. Хуснутдинова
"... . Fatini Cinzia MD, PhD; Sticchi, Elena BS, Marcucci, Ros- salla MD, PhD et al. ACE Insertion/Deletion, but ..."
 
Том 14, № 12 (2015) Аллельный полиморфизм генов, ассоциированных с активностью плазменного звена гемостаза, и риск венозного тромбоэмболизма у лиц молодого возраста Аннотация  PDF (Rus)  похожие документы
А. В. Демьяненко, С. И. Капустин, В. В. Сорока, П. В. Чечулов
"... 1-ãî òèïà (PAI-1 -675 4G/5G), òêàíåâîãî àêòèâàòîðà ïëàçìèíîãåíà (TPA, 311 ï.í. Ins/Del), à òàê- æå ..."
 
1 - 50 из 79 результатов 1 2 > >> 

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)