Preview

Медицинская генетика

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
Том 14, № 11 (2015) Редкий хромосомный дисбаланс у плода: опыт применения метода чиповой сравнительной геномной гибридизации (aCGH) (клиническое наблюдение) Аннотация  PDF (Rus)  похожие документы
Н. А. Каретникова, А. Н. Екимов, Е. Е. Баранова, В. А. Бахарев, Д. Ю. Трофимов, А. И. Гус
"... by array comparative genomic hybridization (aCGH) in a fetus with increased nuchal translucency and normal ..."
 
Том 14, № 5 (2015) ПРИМЕНЕНИЕ МЕТОДА МИКРОМАТРИЧНОЙ СРАВНИТЕЛЬНОЙ ГЕНОМНОЙ ГИБРИДИЗАЦИИ В ПРЕНАТАЛЬНОЙ ДИАГНОСТИКЕ Аннотация  PDF (Rus)  похожие документы
Н. А. Каретникова, А. Н. Екимов, Е. Е. Баранова, В. А. Бахарев, Д. Ю. Трофимов, А. И. Гус
"... (aCGH) during examining fetuses with increasing of the nuchal translucency and normal karyotype in the I ..."
 
Том 13, № 7 (2014) АУДИТ РАННЕГО ПРЕНАТАЛЬНОГО СКРИНИНГА В СУБЪЕКТАХ РОССИЙСКОЙ ФЕДЕРАЦИИ.ЧАСТЬ 1. АЛТАЙСКИЙ КРАЙ — ПЕРМСКИЙ КРАЙ Аннотация  PDF (Rus)  похожие документы
Л. А. Жученко, П. А. Голошубов , Е. Н. Андреева , Е. А. Калашникова , Е. В. Юдина , А. Ш. Латыпов , В. Л. Ижевская , О. С. Филиппов , А. М. Никонов, Е. А. Корзникова , О. В. Чекрий , В. А. Самохвалов , В. В. Шальнев , А. Г. Судаков , Л. Н. Немцова , Л. П. Чунихина , Т. Ю. Поздеева, О. А. Фесик , С. В. Кузнецова , О. А. Новолоцкая , И. А. Лаптева , Е. Г. Петрова , В. Н. Грященко, О. В. Касимова , Н. В. Курбангалиева , Н. П. Зернаева , Ю. А. Корнева , Ю. В. Воронова , С. В. Виноглядова , И. А. Шаповалова , Т. В. Федотова , Е. В. Колпакова , Г В. Киреева , В. П. Федотов , М. И. Климова , Е. Ю. Машнева , В. В. Мельников , Ю. Л. Маюн , И. А. Панина , Е. Н. Бунина , Т. П. Жукова , И. Л. Артемичева , Е. И. Кутовая , Е. Ю. Хромова , Т. Н. Самойлова , А. Н. Филипчук , И. А. Зуева , Н. Н. Лунина , Н. И. Гарцман , М. А. Новик , О. Б. Стяжкина , Г. В. Азаровская , Н. И. Лазарева , И. А. Кузьмичева , В. А. Кавочкина , Т. Т. Дмитриева , М. Б. Шамакова , А. В. Лычак , Д. И. Лысенко, А. Д. Магатина , М. Г. Алексеева , Ю. Ю. Елесина , И. А. Ботвиньева , Т. Е. Серебренникова , Е. В. Стародумова , Т. А. Ситякова, Е. В. Юферева , С. А. Матулевич , О. В. Бареева , Н. Е. Павленко , Н. В. Кривоносова , Е. П. Геворкян , Т. Ю. Елизарьева , О. В. Болдырева , А. Е. Шевченко , Я. В. Харитонова , А. В. Титова , Т. М. Мораш , О. П. Павельева , М. А. Кожухов , А. Н. Кеня , Н. И. Кононенко , Н. Н. Ржевкина , М. В. Кононова , К. О. Кудрявцева , Г. Л. Тюрина , М. А. Железнова , Г. В. Комкова , Т. Н. Кекеева, Ф. К. Лагкуева , Н. О. Одегова , С. В. Степнова , М. Г. Селютина , Е. Ю. Воскобоева , О. Н. Давыдова , А. С. Иванюк , С. Н. Кокаровцева , Е. А. Семенова , Н. А. Серкова , А. И. Соколова , Е. В. Судакова , Т. Г. Цветкова , И. В. Мирошникова , О. Ф. Чернякина , С. В. Сосницкая , Т. В. Лукьянова , Т. М. Некрасова, Т. П. Гапай , П В. Оськина , О. А. Скоробогатько , Е. А. Новикова , О. И. Костина , А. И. Ример , О. Ю. Шушарина-Левун , Н. Ю. Герасименко , Е. Б Костенко , Т. И. Долгих, Е. Ю. Беляшова , И. П. Цымбалова , А. Е. Осокин , Т. Я. Полунова , Е. В. Шелкова , Л. В. Касьянова , О. А. Рязанова , И. А. Дудкин , О. В. Филиппова , Е. А. Стародубова , Т. Н. Евсеева , Л. А. Солуянова , В. И. Курилова , З. Н. Сахтарьёк, З. Р. Дзыбова , Л. Н. Ткаченко , Ф. М. Байрамгулов , А. К. Марданова , М. К. Ахмадуллина , В. В. Сангизова , Е. Р. Еремина , З. А. Юмтарова , В. Н. Беляева , Г. Ш. Шарапова , М. В. Артемьева , Е. В. Шведун, Т. А. Малинина , А. Э Баринова , Т. Л. Алексеева , Л. В. Коленченко , М. В. Тимохина , В. М. Казанцева , И. В. Жуков , Л. Н. Альмиз , С. С. Храмихина, Л. Ю. Кондрашова , В. И. Семина , З. И. Вафина , Л. Е. Терегулова , Л. И. Двуреченская , И. Г. Вардамова , О. М. Шипачева , Л. А. Тайзутдинова , А. В. Абусева , О. А. Токтарова , Л. А. Новикова , О. В. Чильгашева , Е. А. Кожевникова , О. К. Тогочакова , И. М. Жиглова , Н. Н. Можаева , Ю. О Бордаева , Р. А. Шокарев , Г. И. Якубовский, Н. М. Касатина , О. Б. Серебрякова , Е. И. Шумская , О. В. Круглова , Т. А. Тезикова , Т. К. Кащеева , А. Л. Коротеев , О. П. Романенко , К. П. Карпов , Д. В. Воронин , Н. В. Вохмянина , А. В. Биньковская , Н. П. Ивченкова , Л. А. Лернер , Т. Е. Занорина , Э. И. Костырко , О. А. Талолина, Е. Б. Николаева , Е. Ф. Шаманская , В. В. Ворошнин , Н. В. Лукина , Е. А. Степанькова , Н. Я. Румянцева, Т. М. Романкова , Л. В. Агеева , Н. Г. Лиманская , Н. В. Бутко , А. Н. Петрова , Т. И. Асеева , Е. В. Панкова, И. А. Федорова , Л. П. Назаренко , А. А. Рудко , М. О Филиппова , М. П. Корф , С. Л. Вовк , К. В. Пузырев , Т. В. Юдинцева , Ф. Я. Заикина , Л. Л. Гребенкина , В. В. Михальчук , А. Г. Новоселов , Е. Ф. Хмелева , Е. В. Осипова , О. П. Кузнецова , Н. Е. Васильева , Н. В. Сикора , М. В. Никишина , Н. В. Моисеева , Л. Н. Колбасин , Н. Е. Потапова , С. Р. Зубайдуллина , И. В. Бойко , С. Ю. Шумаков , Т. К. Фоминых , Е. Н. Саваскина , Л. П. Майкова , Д. А. Казенова , В. Б. Веледницкий , Н. С. Абрамова , Е. В. Гонтова , А. А. Сягин , К. А. Шершнева , Ю. С. Сахарова , М. Ю. Абросимова , Л. Н. Зарчукова , Е. С. Некрасова
 
Том 13, № 8 (2014) АУДИТ РАННЕГО ПРЕНАТАЛЬНОГО СКРИНИНГА В СУБЪЕКТАХ РОССИЙСКОЙ ФЕДЕРАЦИИ. ЧАСТЬ 2. РЕСПУБЛИКА АДЫГЕЯ — ЯРОСЛАВСКАЯ ОБЛАСТЬ Аннотация  PDF (Rus)  похожие документы
Л. А. Жученко, П. А. Голошубов , Е. Н. Андреева , Е. А. Калашникова , Е. В. Юдина , А. Ш. Латыпов , В. Л. Ижевская , О. С. Филиппов , А. М. Никонов, Е. А. Корзникова , О. В. Чекрий , В. А. Самохвалов , В. В. Шальнев , А. Г. Судаков , Л. Н. Немцова , Л. П. Чунихина , Т. Ю. Поздеева, О. А. Фесик , С. В. Кузнецова , О. А. Новолоцкая , И. А. Лаптева , Е. Г. Петрова , В. Н. Грященко, О. В. Касимова , Н. В. Курбангалиева , Н. П. Зернаева , Ю. А. Корнева , Ю. В. Воронова , С. В. Виноглядова , И. А. Шаповалова , Т. В. Федотова , Е. В. Колпакова , Г В. Киреева , В. П. Федотов , М. И. Климова , Е. Ю. Машнева , В. В. Мельников , Ю. Л. Маюн , И. А. Панина , Е. Н. Бунина , Т. П. Жукова , И. Л. Артемичева , Е. И. Кутовая , Е. Ю. Хромова , Т. Н. Самойлова , А. Н. Филипчук , И. А. Зуева , Н. Н. Лунина , Н. И. Гарцман , М. А. Новик , О. Б. Стяжкина , Г. В. Азаровская , Н. И. Лазарева , И. А. Кузьмичева , В. А. Кавочкина , Т. Т. Дмитриева , М. Б. Шамакова , А. В. Лычак , Д. И. Лысенко, А. Д. Магатина , М. Г. Алексеева , Ю. Ю. Елесина , И. А. Ботвиньева , Т. Е. Серебренникова , Е. В. Стародумова , Т. А. Ситякова, Е. В. Юферева , С. А. Матулевич , О. В. Бареева , Н. Е. Павленко , Н. В. Кривоносова , Е. П. Геворкян , Т. Ю. Елизарьева , О. В. Болдырева , А. Е. Шевченко , Я. В. Харитонова , А. В. Титова , Т. М. Мораш , О. П. Павельева , М. А. Кожухов , А. Н. Кеня , Н. И. Кононенко , Н. Н. Ржевкина , М. В. Кононова , К. О. Кудрявцева , Г. Л. Тюрина , М. А. Железнова , Г. В. Комкова , Т. Н. Кекеева, Ф. К. Лагкуева , Н. О. Одегова , С. В. Степнова , М. Г. Селютина , Е. Ю. Воскобоева , О. Н. Давыдова , А. С. Иванюк , С. Н. Кокаровцева , Е. А. Семенова , Н. А. Серкова , А. И. Соколова , Е. В. Судакова , Т. Г. Цветкова , И. В. Мирошникова , О. Ф. Чернякина , С. В. Сосницкая , Т. В. Лукьянова , Т. М. Некрасова, Т. П. Гапай , П В. Оськина , О. А. Скоробогатько , Е. А. Новикова , О. И. Костина , А. И. Ример , О. Ю. Шушарина-Левун , Н. Ю. Герасименко , Е. Б Костенко , Т. И. Долгих, Е. Ю. Беляшова , И. П. Цымбалова , А. Е. Осокин , Т. Я. Полунова , Е. В. Шелкова , Л. В. Касьянова , О. А. Рязанова , И. А. Дудкин , О. В. Филиппова , Е. А. Стародубова , Т. Н. Евсеева , Л. А. Солуянова , В. И. Курилова , З. Н. Сахтарьёк, З. Р. Дзыбова , Л. Н. Ткаченко , Ф. М. Байрамгулов , А. К. Марданова , М. К. Ахмадуллина , В. В. Сангизова , Е. Р. Еремина , З. А. Юмтарова , В. Н. Беляева , Г. Ш. Шарапова , М. В. Артемьева , Е. В. Шведун, Т. А. Малинина , А. Э Баринова , Т. Л. Алексеева , Л. В. Коленченко , М. В. Тимохина , В. М. Казанцева , И. В. Жуков , Л. Н. Альмиз , С. С. Храмихина, Л. Ю. Кондрашова , В. И. Семина , З. И. Вафина , Л. Е. Терегулова , Л. И. Двуреченская , И. Г. Вардамова , О. М. Шипачева , Л. А. Тайзутдинова , А. В. Абусева , О. А. Токтарова , Л. А. Новикова , О. В. Чильгашева , Е. А. Кожевникова , О. К. Тогочакова , И. М. Жиглова , Н. Н. Можаева , Ю. О Бордаева , Р. А. Шокарев , Г. И. Якубовский, Н. М. Касатина , О. Б. Серебрякова , Е. И. Шумская , О. В. Круглова , Т. А. Тезикова , Т. К. Кащеева , А. Л. Коротеев , О. П. Романенко , К. П. Карпов , Д. В. Воронин , Н. В. Вохмянина , А. В. Биньковская , Н. П. Ивченкова , Л. А. Лернер , Т. Е. Занорина , Э. И. Костырко , О. А. Талолина, Е. Б. Николаева , Е. Ф. Шаманская , В. В. Ворошнин , Н. В. Лукина , Е. А. Степанькова , Н. Я. Румянцева, Т. М. Романкова , Л. В. Агеева , Н. Г. Лиманская , Н. В. Бутко , А. Н. Петрова , Т. И. Асеева , Е. В. Панкова, И. А. Федорова , Л. П. Назаренко , А. А. Рудко , М. О Филиппова , М. П. Корф , С. Л. Вовк , К. В. Пузырев , Т. В. Юдинцева , Ф. Я. Заикина , Л. Л. Гребенкина , В. В. Михальчук , А. Г. Новоселов , Е. Ф. Хмелева , Е. В. Осипова , О. П. Кузнецова , Н. Е. Васильева , Н. В. Сикора , М. В. Никишина , Н. В. Моисеева , Л. Н. Колбасин , Н. Е. Потапова , С. Р. Зубайдуллина , И. В. Бойко , С. Ю. Шумаков , Т. К. Фоминых , Е. Н. Саваскина , Л. П. Майкова , Д. А. Казенова , В. Б. Веледницкий , Н. С. Абрамова , Е. В. Гонтова , А. А. Сягин , К. А. Шершнева , Ю. С. Сахарова , М. Ю. Абросимова , Л. Н. Зарчукова , Е. С. Некрасова
 
Том 15, № 7 (2016) Случай кампомелической дисплазии у плода 1 триместра: ультразвуковые и морфологические признаки Аннотация  PDF (Rus)  похожие документы
А. А. Лазаревич, И. В. Новикова
"... of gestation. The ultrasound examination showed increased nuchal translucency and abnormally short and bowed ..."
 
Том 12, № 1 (2013) МОЛЕКУЛЯРНОЕ КАРИОТИПИРОВАНИЕ (ACGH) КАК СОВРЕМЕННЫЙ ПОДХОД К ИССЛЕДОВАНИЮ ПРИЧИН НЕВЫНАШИВАНИЯ БЕРЕМЕННОСТИ Аннотация  PDF (Rus)  похожие документы
Т. В. Никитина, А. А. Кашеварова, Н. А. Скрябин, Н. Н. Чечеткина, И. Н. Лебедев, А. А. Мельников
"... . Array-based comparative genomic hybridization (aCGH) can overcome some of these limitations ..."
 
Том 15, № 5 (2016) Вариабельность генетического дисбаланса по хромосоме 1 в некультивированных клетках миом матки Аннотация  PDF (Rus)  похожие документы
А. С. Кольцова, О. В. Малышева, А. А. Пендина, О. А. Ефимова, А. Н. Каминская, Н. С. Осиновская, И. Ю. Султанов, Н. Ю. Швед, А. В. Тихонов, В. С. Баранов
"... ). The spectrum of chromosome 1 aberrations was revealed by aCGH. The frequency of cells containing chromosome 1 ..."
 
Том 17, № 3 (2018) Анализ CNVs при анэмбрионии и неразвивающейся беременности Аннотация  PDF (Rus)  похожие документы
Р. Р. Савченко, А. А. Кашеварова, Н. А. Скрябин, Д. И. Жигалина, М. Е. Лопаткина, Т. В. Никитина, С. А. Васильев, И. Н. Лебедев
"... (aCGH) на ДНК-микрочипах высокого разрешения. Выявлено 299 CNVs при анэмбрионии и 132 CNVs при ..."
 
Том 15, № 4 (2016) Микродупликация 12q24.12 у пациента с фармакорезистентной эпилепсией и задержкой развития Аннотация  PDF (Rus)  похожие документы
Е. О. Беляева, Л. П. Назаренко, А. А. Кашеварова, Н. Н. Скрябин, И. Н. Лебедев
"... microduplication at 12q24.12 of maternal origin was detected by aCGH. Patient has marked physical and mental ..."
 
Том 15, № 7 (2016) Значимость молекулярного кариотипирования для уточнения диагноза при цитогенетически визуализируемой хромосомной патологии Аннотация  PDF (Rus)  похожие документы
Е. О. Беляева, А. А. Кашеварова, А. М. Никонов, О. В. Плотникова, Н. А. Скрябин, Л. П. Назаренко, И. Н. Лебедев
"... . Microdeletions 22q13.32-q13.33 and 3q13.31 were detected by aCGH (860K, Agilent Technologies). Results ..."
 
Том 17, № 10 (2018) Врожденный миастенический синдром с дыхательной недостаточностью, тип 20 Аннотация  похожие документы
Т. В. Кожанова, С. С. Жилина, Т. И. Мещерякова, М. Ю. Шорина, И. Ф. Деменьшин, Г. Г. Прокопьев, А. Г. Притыко
"... in the heterozygous state, the father has no the same mutation. One cannot exclude the presence of gonadal mosaicism ..."
 
Том 14, № 12 (2015) Ганглиозидоз GM2 у взрослых: первое российское наблюдение и обзор литературы Аннотация  PDF (Rus)  похожие документы
Г. Е. Руденская, А. М. Букина, Т. М. Букина, С. Н. Иллариошкин, С. А. Клюшников, Е. Ю. Воскобоева, Е. Ю. Захарова
"... or adult. A case of chronic TS in a 27-year-old female of mixed ethnicity (Russian mother and Tatar father ..."
 
Том 16, № 5 (2017) Идентификации двух мутаций в транс-положении в гене CYP21A2 у плода без врожденной дисфункции коры надпочечников (ВДКН). Случай пренатальной диагностики Аннотация  PDF (Rus)  похожие документы
Н. С. Осиновская, И. Ю. Султанов
"... » gene copy, which was inherited from the father, were identified in the DNA samples from chorionic villi ..."
 
Том 17, № 2 (2018) Интерхромосомная и интрахромосомная инсерции с участием хромосомы 2 Аннотация  PDF (Rus)  похожие документы
М. Е. Миньженкова, Ж. Г. Маркова, Е. Л. Дадали, Н. В. Шилова
"... were derived from fathers having a balanced insertion. In case 1 patient was referred for evaluation ..."
 
Том 17, № 3 (2018) Спектр структурных вариаций генома у больных с ишемической болезнью сердца Аннотация  PDF (Rus)  похожие документы
А. А. Слепцов, М. С. Назаренко, Н. А. Скрябин, А. Н. Казанцев, О. Л. Барбараш, В. П. Пузырев
"... comparative genome hybridization (aCGH) has not previously been conducted. The goal of our study ..."
 
Том 17, № 7 (2018) МУТАЦИЯ ГЕНА AQP5 - ПРИЧИНА ЛАДОННО-ПОДОШВЕННОГО ГИПЕРКЕРАТОЗА В РОССИЙСКОЙ СЕМЬЕ Аннотация  похожие документы
О. А. Щагина, В. П. Федотов, Т. В. Федотова, А. В. Поляков
"... 368 (52 631 kb). The area was limited within D12S1661 (48 607kb): Lod - 2.61    = 0 and D12S1586 (54 ..."
 
Том 17, № 3 (2018) Клинический случай редкой органической ацидурии Аннотация  PDF (Rus)  похожие документы
Е. Р. Еремина
"... in the literature. Father and mother of the proband heterozygous state mutation is found. The family received ..."
 
Том 17, № 2 (2018) Влияние инактивации Х-хромосомы на фенотипические проявления транслокаций Х;аутосома Аннотация  PDF (Rus)  похожие документы
Е. Н. Толмачёва, Н. А. Скрябин, Г. Н. Сеитова, Н. Н. Суханова, А. Д. Черемных, Л. П. Назаренко, И. Н. Лебедев
"... , the phenotype of the patient may be affected by the additional microdeletion that was found by aCGH at the 22q11 ..."
 
Том 17, № 3 (2018) Аrray-CGH в диагностике геномных болезней у детей с врожденными пороками сердца и экстракардиальной патологией Аннотация  PDF (Rus)  похожие документы
А. А. Слепухина, Н. А. Скрябин, А. А. Кашеварова, М. А. Новикова, Г. И. Лифшиц, И. Н. Лебедев
"... 7q11.23, microdeletion 1p36, microduplication at the 20p13. Thus, aCGH has a high diagnostic power ..."
 
Том 17, № 12 (2018) Поиск мутаций в генах PAX3, MITF, SOX10 и SNAI2 при синдроме Ваарденбурга в Якутии Аннотация  похожие документы
Ф. М. Терютин, В. Г. Пшенникова, У. П. Борисова, Н. А. Барашков, Г. П. Романов, А. В. Соловьев, А. А. Бондарь, И. В. Морозов, Л. У. Джемилева, Э. К. Хуснутдинова, М. И. Томский, О. Л. Посух, С. А. Федорова
"... .804C>T (p.Asn268Asn) in gene PAX3 and in her father - c.927C>T (p.His309His) in gene SOX10 . Both ..."
 
Том 15, № 4 (2016) Молекулярное кариотипирование при недифференцированных формах интеллектуальных расстройств: от хромосомных мутаций к идентификации патогенетически значимых генов Аннотация  PDF (Rus)  похожие документы
А. А. Кашеварова, Н. А. Скрябин, М. Е. Лопаткина, О. А. Салюкова, М. Н. Филимонова, О. В. Лежнина, А. Р. Шорина, А. Б. Масленников, Л. П. Назаренко, V. . Culic, И. Н. Лебедев
"... , is a candidate for ID. Conclusions. aCGH-analysis is an effective method for genetic diagnosis, which, when ..."
 
Том 17, № 1 (2018) Неслучайное распределение кариотипов эмбрионов у женщин с привычным невынашиванием беременности Аннотация  PDF (Rus)  похожие документы
Т. В. Никитина, Д. И. Жигалина, Е. А. Саженова, Е. Н. Толмачева, Н. А. Скрябин, И. Н. Лебедев
"... a combination of methods: standard cytogenetic analysis (73), CGH (29), FISH and aCGH (3 samples each). 35% (18 ..."
 
Том 15, № 2 (2016) Результаты использования новых медицинских технологий «Детекция основных точковых мутаций гена PAH методом мультиплексной лигазной реакции» и «Детекция десяти дополнительных точковых мутаций гена PAH методом мультиплексной лигазной реакции» в ДНК-диагностике фенилкетонурии Аннотация  PDF (Rus)  похожие документы
П. . Гундорова, А. А. Степанова, О. А. Щагина, А. В. Поляков
"... GGGATTTCTTGGGTGGCCTGAAACATTATCTTTAATTTACTATTTAATTTTCTTG GATGCGATCCGATGCCTTCATG MLPR261 N CTCCATGCCAACAGTCGACATC GATGTACTGTGTGCAGTGGAAGACTC MLPR261 M ..."
 
Том 15, № 6 (2016) Изучение взаимосвязи генотипов (РАН) и фенотипов у больных фенилкетонурией Ростовской области Аннотация  PDF (Rus)  похожие документы
М. А. Амелина, Р. А. Зинченко, А. А. Степанова, П. . Гундорова, А. В. Поляков, С. С. Амелина
"... : IVS12+1G>A (3,85%), IVS10-11G>A(3,85%), R261Q (3,85%), P281L (2,69%), R158Q (2,69%), R252W (1,92%), EX ..."
 
Том 15, № 8 (2016) Семейный случай синдрома Вильямса в трех поколениях Аннотация  PDF (Rus)  похожие документы
О. М. Хурс, Н. В. Румянцева, В. Д. Кулак, И. В. Наумчик, О. Л. Зобикова, О. А. Громыко
"... Willi- ams-Beuren syndrome in a father and son with haploinsufficiency for FKBP6. Clin Dysmorphol. 2005 ..."
 
Том 15, № 8 (2016) Молекулярная эпидемиология наследственной патологии в десяти популяциях Карачаево-Черкесской Республики Аннотация  PDF (Rus)  похожие документы
А. Х. Макаов, Р. А. Зинченко, О. В. Хлебникова, Л. К. Михайлова, Н. В. Петрова, П. . Гундорова, Н. Е. Петрина, Т. А. Васильева, А. В. Марахонов, Т. А. Адян, А. В. Поляков, Е. К. Гинтер
"... ,25%) ìóòàöèè R261X (69 èç 80 àëëåëåé) ó êàðà÷àåâöåâ. Òðèäöàòü îäèí ïàöèåíò îêàçàëèñü ãîìîçèòíûì ïî ìóòàöèè R261 ..."
 
Том 15, № 5 (2016) Поиск молекулярных путей и белковых партнеров CNTN6 в регуляции краниогенеза Аннотация  PDF (Rus)  похожие документы
М. Е. Лопаткина, А. А. Кашеварова, Н. А. Скрябин, А. Р. Шорина, А. Б. Масленников, Л. П. Назаренко, И. Н. Лебедев
"... ðàññòðîéñòâàìè è àíîìàëèÿìè ÷åðåïà ¹ Ðåçóëüòàòû aCGH (ïî ISCN (2013)) Ðàçìåð, ìëí ï.í. KEGG-ïóòè Ãåíû-êàíäèäàòû ..."
 
Том 14, № 2 (2015) ТЕЗИСЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... ñîõðàíåíèå ãåíîôîíäîâ». Îñîáåííîñòè êëèíè÷åñêèõ ïðîÿâëåíèé ôåíèëêåòîíóðèè ïðè ãåíîòèïå R261X/E178G: îïèñàíèå ..."
 
Том 14, № 12 (2015) Медико-генетическое обследование населения г.Черкесска Карачаево-Черкесской Республики Аннотация  PDF (Rus)  похожие документы
Р. А. Зинченко, А. Х. Макаов, В. А. Галкина, Е. Л. Дадали, О. В. Хлебникова, Л. К. Михайлова, Н. В. Петрова, Н. Е. Петрина, Т. А. Васильева, А. Н. Петрин, В. В. Стрельников, А. В. Поляков, Е. К. Гинтер
"... ïàöèåíòà; R413P/L48S è R413P/R261X (n = 2/2) — ó àáàçèí (äâîþðîäíûå ñèáñû); R261X/F331S (n = 1/1) è R261X ..."
 
Том 15, № 4 (2016) Распространение реципрокных анеуплоидий на преимплантационном этапе развития на основе данных молекулярного кариотипирования внеклеточной ДНК бластоцисты Аннотация  PDF (Rus)  похожие документы
Д. И. Жигалина, Н. А. Скрябин, В. Г. Артюхова, А. В. Светлаков, И. Н. Лебедев
"... áëàñòîöèñò íà ÂÊÌ è ÒÝ äëÿ äàëüíåéøåãî aCGH-àíàëèçà. Ïîýòîìó ÷àñòü àíåóïëîèäèé ìîãëà áûòü íå âûÿâëåíà ïî ìåòî ..."
 
Том 14, № 4 (2015) ТЕЗИСЫ ВСЕРОССИЙСКОЙ НАУЧНО-ПРАКТИЧЕСКОЙ КОНФЕРЕНЦИИ «ПРЕНАТАЛЬНАЯ ДИАГНОСТИКА НАСЛЕДСТВЕННЫХ И ВРОЖДЕННЫХ ЗАБОЛЕВАНИЙ: НАСТОЯЩЕЕ И БУДУЩЕЕ», САНКТ-ПЕТЕРБУРГ, 22—23 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... ðàçâèòèÿ. Â íàñòîÿùåå âðåìÿ ðàçðàáîòàíà ìåòîäèêà ñðàâíè- òåëüíîé ãåíîìíîé ãèáðèäèçàöèè (aCGH), êîòîðàÿ ..."
 
Том 14, № 11 (2015) Сравнение репродуктивных параметров и индекса Кроу сельских карачаевцев и черкесов Аннотация  PDF (Rus)  похожие документы
Г. И. Ельчинова, А. Х. Макаов, Р. А. Зинченко
"... .ð.) 0,051 0,305 0,371 Êàðà÷àåâöû (1960 ã.ð. è ïîçæå) 0,027 0,227 0,261 Ðèñ. 2. Ãðàôè÷åñêèé àíàëèç ..."
 
Том 15, № 5 (2016) Поиск мутаций в гене синдрома Блума (BLM) у пациентов с раком предстательной железы Аннотация  PDF (Rus)  похожие документы
Г. Б. Кунсбаева, И. Р. Гилязова, М. А. Янкина, Е. А. Климентова, В. Н. Павлов, Э. К. Хуснутдинова
"... ) ëîêàëèçîâàí íà õðîìîñî- ìå 15, â îáëàñòè q26.1, ñîñòîèò èç 22 ýêçîíîâ è êîäèðóåò áåëîê, ñîñòîÿùèé èç 1417 ..."
 
Том 14, № 4 (2015) МАТЕРИАЛЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И МАТЕРИАЛЫ 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... àëëåëü p.Leu483Pro (c.1448T>C), êîòîðûé âñòðåòèëñÿ â 47 (26,1%) èç 180 àëëåëüíûõ âàðèàíòîâ ãåíà GBA. Ïðè ..."
 
Том 15, № 2 (2016) Генетическая гетерогенность менделирующих заболеваний и ДНК-диагностика Аннотация  PDF (Rus)  похожие документы
А. В. Поляков, О. А. Щагина
"... >A (c.1315+1G>A), IVS10-11G>A (c.1066-11G>A), R252W (c.754C>T), P281L (c.842C>T), R261Q (c.782G>A), R ..."
 
Том 15, № 9 (2016) Генетические аспекты расстройств аутистического спектра Аннотация  PDF (Rus)  похожие документы
Н. А. Семенова
"... 195 èññëåäóåìûõ (26,1%), èñêëþ÷àÿ äîáðîêà÷åñòâåííûå âàðèàöèè ÷èñëà êîïèé â ñîîòâåòñò- âèè ñ Áàçîé ..."
 
Том 15, № 7 (2016) Оценка груза моногенных наследственных болезней у карачевцев Карачаево-Черкесской Республики в эру новых технологий в диагностике Аннотация  PDF (Rus)  похожие документы
Р. А. Зинченко, А. Х. Макаов, Г. И. Ельчинова, Е. К. Гинтер
"... ,39 0,56 ± 0,28 5,99 ± 0,65 1:167 ï.Êàâêàçñêèé 2,13 ± 0,67 1,28 ± 0,52 0,85 ± 0,60 3,83 ± 0,90 1:261 ..."
 
Том 12, № 2 (2013) ПОЛИМОРФИЗМ C677TГЕНА MTHFR И РИСК ФОРМИРОВАНИЯ НЕСИНДРОМАЛЬНЫХ ОРОФАЦИАЛЬНЫХ РАСЩЕЛИН Аннотация  PDF (Rus)  похожие документы
Т. И. Мещерякова, С. И. Маркова, С. С. Жилина, Г. В. Гончаков, С. Г. Гончакова, А. А. Абрамов, А. Н. Петрин, Г. Р. Мутовин
"... fo la te Re duc ta se Ge ne Va ri ants C677T and A1298C on the Risk of Oro fa ci al Clefts in 261 ..."
 
Том 14, № 10 (2015) Исследование полиморфизмов гена CYP2C9 у женщин, принимающих вальпроаты Аннотация  PDF (Rus)  похожие документы
Д. В. Дмитренко, Н. А. Шнайдер
"... . Sci. — 2006. — Vol. 94, ¹ 2. — P. 261—271. 17. Kumari R., Lakhan R., Garg R.K. et al. Pharmacogenomic ..."
 
Том 14, № 3 (2015) ТЕЗИСЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
 
Том 16, № 1 (2017) Влияние однонуклеотидных полиморфизмов генов TNF и LTA на клинические параметры и маркеры воспаления у пациентов с муковисцидозом Аннотация  PDF (Rus)  похожие документы
Г. В. Шмарина, Д. А. Пухальская, А. М. Букина, Л. В. Авакян, С. Ю. Семыкин, Е. Л. Амелина, С. А. Красовский, М. Ю. Усачева, В. А. Алешкин
"... AA-LTA+252GG (n = 97) Ýëà ñ òà çà, ïêã/ìë (1,98 ïêã/ìë) 84,6 (29,8 ¸ 815,3) 70,6 (26,1 ¸ 233,3) 0 ..."
 
Том 15, № 11 (2016) Неоцентромеры Аннотация  PDF (Rus)  похожие документы
Н. В. Шилова
"... evo lu ti on. Am J Hum Ge net. 2008;82(2):261-282. 23. Ven tu ra M, Mud ge J, Pa lum boV et al. Ne o ..."
 
Том 15, № 10 (2016) Результаты использования медицинской технологии определения наиболее частых анеуплоидий методом многолокусной количественной флуоресцентной ПЦР Аннотация  PDF (Rus)  похожие документы
В. В. Стрельников, Е. Б. Кузнецова, М. А. Иванов, В. В. Землякова, Д. В. Залетаев
"... : GACCTTTGGAAAGCTAGTGT 237—261 ~0,85 DXS6809 F: FAM-TGAACCTTCCTAGCTCAGGA R:TCTGGAGAACCAATTTTGC 241—273 ~0,80 DXS6803 F ..."
 
Том 15, № 1 (2016) Генетика мигрени Аннотация  PDF (Rus)  похожие документы
Н. С. Кондратьева, А. А. Анучина, З. Г. Кокаева, Е. А. Наумова, Ю. Э. Азимова, А. В. Сергеев, К. В. Скоробогатых, Г. Р. Табеева, Е. А. Климов
 
Том 14, № 5 (2015) АССОЦИАЦИИ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ ПОДВЕРЖЕННОСТИ БРОНХИАЛЬНОЙ АСТМЕ Аннотация  PDF (Rus)  похожие документы
Н. П. Бабушкина, Е. Ю. Брагина, С. В. Буйкин, И. В. Салтыкова, М. С. Назаренко, Н. В. Тарасенко, Е. В. Кулиш, В. В. Маркова, О. Г. Половкова, А. Н. Кучер
"... .Á., Ïóçûðåâ Â.Ï. Ñèíòðîïíûå ãåíû àëëåðãè÷å- ñêèõ çàáîëåâàíèé // Ãåíåòèêà. — 2010. — Ò. 46. — Ñ. 255—261. 10 ..."
 
Том 12, № 3 (2013) ГЕНЕТИЧЕСКИЕ АСПЕКТЫ СУИЦИДАЛЬНОГО ПОВЕДЕНИЯ Аннотация  PDF (Rus)  похожие документы
А. Г. Зайнуллина, З. Л. Халилова, Э. К. Хуснутдинова
"... ôóí ê öè î íà ëü íîé çíà ÷è ìî ñòè ðå ãè î íà Xq25-26.1, â ïðå äå ëàõ êî òî ðî ãî ëî - êà ëè çî âàí ..."
 
Том 12, № 3 (2013) «ТЕРРИТОРИАЛЬНЫЙ» ПОДХОД К ОТБОРУ ФАМИЛИЙ ПРИ ПОПУЛЯЦИОННО-ГЕНЕТИЧЕСКОМ ИССЛЕДОВАНИИ НАСЕЛЕНИЯ ЮГА ЦЕНТРАЛЬНОЙ РОССИИ Аннотация  PDF (Rus)  похожие документы
И. Н. Сорокина, Е. Н. Крикун, М. И. Чурносов
"... 70,9 46 735 91,9 2459 45,5 38 483 75,7 Áî ðè ñîâ ñêèé 26,1 19 366 3500 2653 75,8 17 253 89,1 1766 50 ..."
 
1 - 48 из 48 результатов

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)