Preview

Медицинская генетика

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
Том 17, № 6 (2018) Изучение роли полиморфизмов генов цитокинов 511C>T IL1, 174G>C IL6, 1082G>A IL10 в развитии хронического панкреатита у русских жителей Центрального Черноземья Аннотация  PDF (Rus)  похожие документы
Т. А. Самгина, П. М. Назаренко, В. А. Лазаренко, Г. А. Животова, А. В. Полоников
"... . Was found: the genotype 511CT IL1 (OR = 1,58 95%CI 1,01-2,48, p = 0,04) and the genotype 1082GA IL10 (OR = 1,58 ..."
 
Том 15, № 5 (2016) Роль полиморфизма генов IL1b (+3953)С/Т и IL8 (-251)А/Т в развитии Н. pylori-ассоциированного хронического гастрита Аннотация  PDF (Rus)  похожие документы
Ю. В. Саранчина, Е. С. Агеева, О. В. Штыгашева, В. М. Иптышев
"... . Key words: Helicobacter pylori, gene polymorphism, interleukin Ââåäåíèå Í.pylori ñòèìóëèðóåò çàïóñê ..."
 
Том 12, № 4 (2013) ВАРИАБЕЛЬНОСТЬ ГЕНОВ ИНТЕРЛЕЙКИНА 4 И ЕГО РЕЦЕПТОРА В ПОПУЛЯЦИЯХ КОРЕННЫХ НАРОДОВ СИБИРИ Аннотация  PDF (Rus)  похожие документы
В. А. Степанов, Е. А. Трифонова, К. В. Симонова, А. А. Чередниченко
"... Genetic diversity of SNP markers of Interleukin 4 alpha and Interleukin 4 receptor genes ..."
 
Том 15, № 3 (2016) Семейная средиземноморская лихорадка: современные представления Аннотация  PDF (Rus)  похожие документы
С. А. Атоян
"... development. However other medications blocking the interleukins are effective in cases of adverse effects ..."
 
Том 16, № 1 (2017) Влияние однонуклеотидных полиморфизмов генов TNF и LTA на клинические параметры и маркеры воспаления у пациентов с муковисцидозом Аннотация  PDF (Rus)  похожие документы
Г. В. Шмарина, Д. А. Пухальская, А. М. Букина, Л. В. Авакян, С. Ю. Семыкин, Е. Л. Амелина, С. А. Красовский, М. Ю. Усачева, В. А. Алешкин
"... ated di a be tes, tu mor ne cro sis fac tor-alpha, lymphotoxin-alpha, interleukin-17, in ter feron ..."
 
Том 15, № 12 (2016) Генетические маркеры фиброгенеза при хроническом вирусном гепатите С Аннотация  PDF (Rus)  похожие документы
И. А. Гончарова, М. С. Назаренко, Н. В. Тарасенко, А. В. Марков, Е. В. Белобородова, В. П. Пузырев
"... variant rs650108 (OR = 1,74, 95%CI: 1,25-2,42; p = 0,0001), and ‘C’ allele of the KIAA1462 gene variant rs ..."
 
Том 16, № 3 (2017) Исследование взаимосвязи полиморфизмов I462V гена CYP1A1 и -9-154C>A гена CYP1A2 c риском развития колоректального рака у русских жителей Центральной России Аннотация  PDF (Rus)  похожие документы
А. С. Москалев, В. О. Солдатов, И. Н. Вдовина, Н. В. Иванова, В. П. Иванов, А. В. Полоников, О. Ю. Бушуева
"... -discrimination assays. We found that the genotype 462II (OR = 1,74, 95% CI = 1,02-2.97, P = 0,04) of the CYP1A1 ..."
 
Том 17, № 2 (2018) Цитогенетические нарушения у больных раком легкого: феномен rogue cells в клетках крови Аннотация  PDF (Rus)  похожие документы
М. Л. Баканова, В. И. Минина, А. А. Тимофеева, Т. А. Головина, Я. А. Савченко, А. В. Рыжкова, Р. А. Титов, М. А. Асанов, В. А. Титов, И. А. Вафин
"... ,000001; c коррекцией на конфаундеры: padj = 0,004). У 8 больных РЛ были зарегистрированы rogue cells (клетки ..."
 
Том 15, № 5 (2016) Исследование ассоциации полиморфных вариантов rs1333040 и rs7865618 хромосомы 9p21 с развитием артериовенозных мальформаций Аннотация  PDF (Rus)  похожие документы
С. А. Эркинова, В. С. Киселёв, Н. В. Стрельников, К. Ю. Орлов, А. В. Дубовой, Е. Н. Воронина, М. Л. Филипенко
"... that the rs7865618 gene CDKN2A is associated with brain arteriovenous malformation (OR = 1,915, CI = [1,158-3 ..."
 
Том 14, № 5 (2015) АССОЦИАЦИИ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ ПОДВЕРЖЕННОСТИ БРОНХИАЛЬНОЙ АСТМЕ Аннотация  PDF (Rus)  похожие документы
Н. П. Бабушкина, Е. Ю. Брагина, С. В. Буйкин, И. В. Салтыкова, М. С. Назаренко, Н. В. Тарасенко, Е. В. Кулиш, В. В. Маркова, О. Г. Половкова, А. Н. Кучер
"... . Chem. Acta. — 2005. — Vol. 354, ¹1—2. — P. 153—158. 17. Pulkkinen A., Viitanen L., Kareinen A. et al ..."
 
Том 16, № 2 (2017) Анализ взаимосвязи полиморфизма A/G (rs1801310) гена GSS с развитием миомы матки: пилотное исследование Аннотация  PDF (Rus)  похожие документы
О. К. Кудрявцева, Е. М. Барышева, М. В. Сорокина, О. Б. Полшведкина, Н. В. Иванова, А. В. Полоников, О. Ю. Бушуева
"... ,67; p = 0,04). Meanwhile we observed the protective effect of AA genotype on the development of UM ..."
 
Том 15, № 12 (2016) Изучение роли полиморфных локусов генов GRM3 и GAD2 в развитии параноидной шизофрении у русских и татар из Башкортостана Аннотация  PDF (Rus)  похожие документы
К. О. Киняшева, А. Э. Гареева, Э. К. Хуснутдинова
"... ,13) of rs187993 polymorphic variant GRM3 gene and the GAD2*T allele (p = 0,01; OR = 1,58) polymorphic locus ..."
 
Том 13, № 11 (2014) АНАЛИЗ АЛЛЕЛЬНОГО ДИСБАЛАНСА ПРИ ГЛИОБЛАСТОМЕ: НОВЫЕ ХРОМОСОМНЫЕ УЧАСТКИ ПОТЕРИ ГЕТЕРОЗИГОТНОСТИ И НОВЫЕ ГЕНЫ-КАНДИДАТЫ Аннотация  PDF (Rus)  похожие документы
Е. А. Алексеева, А. С. Танас, Е. В. Прозоренко, А. М. Зайцев, О. Н. Кирсанова, А. Е. Самарин, Д. В. Залетаев, В. В. Стрельников
"... with the frequencies of 15.8% and 42.3%, respectively, which is consistent with the previously published data. We ..."
 
Том 15, № 4 (2016) Анализ уровня IL-10 в сыворотке крови больных псориазом и псориатическим артритом, носителей различных генотипов полиморфизма С-597А гена IL10 Аннотация  PDF (Rus)  похожие документы
А. А. Барило, М. В. Смольникова, С. В. Смирнова
"... in comparison with carriers of this genotype in the control group (p2,3 = 0,04) and carriers of genotype C ..."
 
Том 15, № 3 (2016) Роль полиморфных локусов генов хемокинов (CCR5, CXCL12 и CCL2) в развитии и рецидивировании рака мочевого пузыря Аннотация  PDF (Rus)  похожие документы
С. М. Измайлова, Л. З. Ахмадишина, А. А. Измайлов, Г. Ф. Корытина, О. В. Кочетова, Г. М. Исхакова, Д. Н. Куватова, А.А. (мл.) Измайлов, В. Н. Павлов, Т. В. Викторова
"... (ìîäåëü äîìèíèðîâàíèÿ, OR = 1,58, 95% CI (1,01—2,47), p = 0,046), îäíàêî ïðè ââåäåíèè ïî- ïðàâêè äàííàÿ ..."
 
Том 13, № 11 (2014) МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ АСПЕКТЫ ЯЗВЕННОЙ БОЛЕЗНИ Аннотация  PDF (Rus)  похожие документы
Э. Х. Шаймарданова, А. Х. Нургалиева, Д. Д. Надыршина, Э. К. Хуснутдинова
"... ñîàâòîðàìè ïðîâåëè àíàëèç àññîöèàöèè îäíîíóêëåîòèäíîé çàìåíû -174G/Ñ (rs1800795) ãåíà IL-6 è óñòàíîâèëè, ÷òî ..."
 
Том 14, № 11 (2015) Исследование полиморфизма гена IL-1B у детей с фебрильными приступами Аннотация  PDF (Rus)  похожие документы
М. А. Строганова, Н. А. Шнайдер, Г. П. Мартынова, Д. В. Дмитренко, Н. В. Терскова, К. А. Газенкампф, Ю. Б. Говорина, А. В. Дюжакова
"... ,0%) 18 (29,0%) 10 (16,1%) 2 (3,2%) ÂÃ×-6 òèïà 11 (17,4%) 15 (24,2%) 0 (0,0%) 16 (25,8%) 12 (19,4%) 3 (4 ..."
 
Том 14, № 12 (2015) Аллельный полиморфизм генов, ассоциированных с активностью плазменного звена гемостаза, и риск венозного тромбоэмболизма у лиц молодого возраста Аннотация  PDF (Rus)  похожие документы
А. В. Демьяненко, С. И. Капустин, В. В. Сорока, П. В. Чечулов
"... variant (OR = 1,6; 95%CI: 1,0-2,6; р = 0,04). Sex-dependent differences were found for FXIII and EPCR ..."
 
Том 15, № 2 (2016) Результаты использования новых медицинских технологий «Детекция основных точковых мутаций гена PAH методом мультиплексной лигазной реакции» и «Детекция десяти дополнительных точковых мутаций гена PAH методом мультиплексной лигазной реакции» в ДНК-диагностике фенилкетонурии Аннотация  PDF (Rus)  похожие документы
П. . Гундорова, А. А. Степанова, О. А. Щагина, А. В. Поляков
"... GATGCGATCCGATGCCTTCATG MLPR158 N CTCCATGCCAACAGTCGACATC GGCAATGTCAGCAAACTGCTTCC MLPR158 M CTCCATGCCAACAGTCGACATC ..."
 
Том 13, № 11 (2014) ИЗУЧЕНИЕ НАСЛЕДСТВЕННЫХ ФОРМ ТУГОУХОСТИ / ГЛУХОТЫ В РЕСПУБЛИКЕ ТЫВА. СООБЩЕНИЕ II. ОЦЕНКА СПЕКТРА МУТАЦИЙ В ГЕНЕGJB2 (CX26) И ИХ ВКЛАДА В ЭТИОЛОГИЮ ПОТЕРИ СЛУХА Аннотация  PDF (Rus)  похожие документы
М. С. Бады-Хоо, А. А. Бондарь, И. В. Морозов, М. В. Зыцарь, В. Ю. Михальская, О. В. Скиданова, Н. А. Барашков, Р. Ш. Монгуш, О. С. Омзар, В. М. Тукар, О. Л. Посух
"... ÷åñòâî áîëüíûõ Îáùåå ÷èñëî áîëüíûõ 201 ×èñëî íåðîäñòâåííûõ ñåìåé ñ áîëüíûìè èíäèâèäàìè * 174 Ïîë ..."
 
Том 12, № 3 (2013) СВОЕОБРАЗИЕ ГЕНОФОНДА РУССКОГО И УКРАИНСКОГО НАСЕЛЕНИЯ БЕЛГОРОДСКОЙ ОБЛАСТИ (ПО ДАННЫМ О ПОЛИМОРФИЗМЕ ШЕСТИ ALU-ИНСЕРЦИЙ) Аннотация  PDF (Rus)  похожие документы
И. Н. Лепендина, И. Н. Сорокина, Н. А. Рудых, Е. В. Балановская, М. И. Чурносов
"... ,43 0,78 0,25 3,74 0,09 0,48 0,10 1,62 0,04 2,05 0,18 0,81 0,01 ÍÎ 0,24 0,15 0,16 0,22 0,44 0,24 0,29 0 ..."
 
Том 16, № 4 (2017) Полиморфизм генов глутатион S-трансфераз и предрасположенность к сахарному диабету 2 типа у жителей Центрального Черноземья Аннотация  PDF (Rus)  похожие документы
Ю. Э. Азарова, А. И. Конопля, А. В. Полоников
"... ,01-6,84, р = 0,04) and GSTТ1 del/del х GSTP1 105Val/Val (OR 4,82, 95%СI 1,21-19,10, р = 0 ..."
 
Том 15, № 6 (2016) Изучение взаимосвязи генотипов (РАН) и фенотипов у больных фенилкетонурией Ростовской области Аннотация  PDF (Rus)  похожие документы
М. А. Амелина, Р. А. Зинченко, А. А. Степанова, П. . Гундорова, А. В. Поляков, С. С. Амелина
"... : IVS12+1G>A (3,85%), IVS10-11G>A(3,85%), R261Q (3,85%), P281L (2,69%), R158Q (2,69%), R252W (1,92%), EX ..."
 
Том 13, № 7 (2014) АУДИТ РАННЕГО ПРЕНАТАЛЬНОГО СКРИНИНГА В СУБЪЕКТАХ РОССИЙСКОЙ ФЕДЕРАЦИИ.ЧАСТЬ 1. АЛТАЙСКИЙ КРАЙ — ПЕРМСКИЙ КРАЙ Аннотация  PDF (Rus)  похожие документы
Л. А. Жученко, П. А. Голошубов , Е. Н. Андреева , Е. А. Калашникова , Е. В. Юдина , А. Ш. Латыпов , В. Л. Ижевская , О. С. Филиппов , А. М. Никонов, Е. А. Корзникова , О. В. Чекрий , В. А. Самохвалов , В. В. Шальнев , А. Г. Судаков , Л. Н. Немцова , Л. П. Чунихина , Т. Ю. Поздеева, О. А. Фесик , С. В. Кузнецова , О. А. Новолоцкая , И. А. Лаптева , Е. Г. Петрова , В. Н. Грященко, О. В. Касимова , Н. В. Курбангалиева , Н. П. Зернаева , Ю. А. Корнева , Ю. В. Воронова , С. В. Виноглядова , И. А. Шаповалова , Т. В. Федотова , Е. В. Колпакова , Г В. Киреева , В. П. Федотов , М. И. Климова , Е. Ю. Машнева , В. В. Мельников , Ю. Л. Маюн , И. А. Панина , Е. Н. Бунина , Т. П. Жукова , И. Л. Артемичева , Е. И. Кутовая , Е. Ю. Хромова , Т. Н. Самойлова , А. Н. Филипчук , И. А. Зуева , Н. Н. Лунина , Н. И. Гарцман , М. А. Новик , О. Б. Стяжкина , Г. В. Азаровская , Н. И. Лазарева , И. А. Кузьмичева , В. А. Кавочкина , Т. Т. Дмитриева , М. Б. Шамакова , А. В. Лычак , Д. И. Лысенко, А. Д. Магатина , М. Г. Алексеева , Ю. Ю. Елесина , И. А. Ботвиньева , Т. Е. Серебренникова , Е. В. Стародумова , Т. А. Ситякова, Е. В. Юферева , С. А. Матулевич , О. В. Бареева , Н. Е. Павленко , Н. В. Кривоносова , Е. П. Геворкян , Т. Ю. Елизарьева , О. В. Болдырева , А. Е. Шевченко , Я. В. Харитонова , А. В. Титова , Т. М. Мораш , О. П. Павельева , М. А. Кожухов , А. Н. Кеня , Н. И. Кононенко , Н. Н. Ржевкина , М. В. Кононова , К. О. Кудрявцева , Г. Л. Тюрина , М. А. Железнова , Г. В. Комкова , Т. Н. Кекеева, Ф. К. Лагкуева , Н. О. Одегова , С. В. Степнова , М. Г. Селютина , Е. Ю. Воскобоева , О. Н. Давыдова , А. С. Иванюк , С. Н. Кокаровцева , Е. А. Семенова , Н. А. Серкова , А. И. Соколова , Е. В. Судакова , Т. Г. Цветкова , И. В. Мирошникова , О. Ф. Чернякина , С. В. Сосницкая , Т. В. Лукьянова , Т. М. Некрасова, Т. П. Гапай , П В. Оськина , О. А. Скоробогатько , Е. А. Новикова , О. И. Костина , А. И. Ример , О. Ю. Шушарина-Левун , Н. Ю. Герасименко , Е. Б Костенко , Т. И. Долгих, Е. Ю. Беляшова , И. П. Цымбалова , А. Е. Осокин , Т. Я. Полунова , Е. В. Шелкова , Л. В. Касьянова , О. А. Рязанова , И. А. Дудкин , О. В. Филиппова , Е. А. Стародубова , Т. Н. Евсеева , Л. А. Солуянова , В. И. Курилова , З. Н. Сахтарьёк, З. Р. Дзыбова , Л. Н. Ткаченко , Ф. М. Байрамгулов , А. К. Марданова , М. К. Ахмадуллина , В. В. Сангизова , Е. Р. Еремина , З. А. Юмтарова , В. Н. Беляева , Г. Ш. Шарапова , М. В. Артемьева , Е. В. Шведун, Т. А. Малинина , А. Э Баринова , Т. Л. Алексеева , Л. В. Коленченко , М. В. Тимохина , В. М. Казанцева , И. В. Жуков , Л. Н. Альмиз , С. С. Храмихина, Л. Ю. Кондрашова , В. И. Семина , З. И. Вафина , Л. Е. Терегулова , Л. И. Двуреченская , И. Г. Вардамова , О. М. Шипачева , Л. А. Тайзутдинова , А. В. Абусева , О. А. Токтарова , Л. А. Новикова , О. В. Чильгашева , Е. А. Кожевникова , О. К. Тогочакова , И. М. Жиглова , Н. Н. Можаева , Ю. О Бордаева , Р. А. Шокарев , Г. И. Якубовский, Н. М. Касатина , О. Б. Серебрякова , Е. И. Шумская , О. В. Круглова , Т. А. Тезикова , Т. К. Кащеева , А. Л. Коротеев , О. П. Романенко , К. П. Карпов , Д. В. Воронин , Н. В. Вохмянина , А. В. Биньковская , Н. П. Ивченкова , Л. А. Лернер , Т. Е. Занорина , Э. И. Костырко , О. А. Талолина, Е. Б. Николаева , Е. Ф. Шаманская , В. В. Ворошнин , Н. В. Лукина , Е. А. Степанькова , Н. Я. Румянцева, Т. М. Романкова , Л. В. Агеева , Н. Г. Лиманская , Н. В. Бутко , А. Н. Петрова , Т. И. Асеева , Е. В. Панкова, И. А. Федорова , Л. П. Назаренко , А. А. Рудко , М. О Филиппова , М. П. Корф , С. Л. Вовк , К. В. Пузырев , Т. В. Юдинцева , Ф. Я. Заикина , Л. Л. Гребенкина , В. В. Михальчук , А. Г. Новоселов , Е. Ф. Хмелева , Е. В. Осипова , О. П. Кузнецова , Н. Е. Васильева , Н. В. Сикора , М. В. Никишина , Н. В. Моисеева , Л. Н. Колбасин , Н. Е. Потапова , С. Р. Зубайдуллина , И. В. Бойко , С. Ю. Шумаков , Т. К. Фоминых , Е. Н. Саваскина , Л. П. Майкова , Д. А. Казенова , В. Б. Веледницкий , Н. С. Абрамова , Е. В. Гонтова , А. А. Сягин , К. А. Шершнева , Ю. С. Сахарова , М. Ю. Абросимова , Л. Н. Зарчукова , Е. С. Некрасова
"... % 2013 ã. 2568 15% 98% 12+4 174 9% 2,7% Ïîêàçàòåëè Ãðóïïà ðèñêà (cut-off 1:100) Ôàêòîðû ðèñêà Ìåäèàíû ..."
 
Том 12, № 2 (2013) ЧАСТОТА ВСТРЕЧАЕМОСТИ ГАМЕТ С АНЕУПЛОИДИЕЙ У МУЖЧИН С НАРУШЕНИЕМ РЕПРОДУКТИВНОЙ ФУНКЦИИ И ПАТОЗООСПЕРМИЕЙ Аннотация  PDF (Rus)  похожие документы
Е. Г. Гордеева, Т. М. Сорокина, Л. В. Шилейко, Т. В. Остроумова, О. С. Борзова, Х. Д. Магомедова, Н. Ю. Кузина, О. В. Баркова, Л. Ф. Курило
"... ,76 47,84±3,06 1,05±0,67* R 0,03—0,75 0,04—0,42 0,26—2,54 0,05—0,19 0,041,74 0—0,29 43,66—52,87 40 ..."
 
Том 17, № 3 (2018) Общность и специфичность генетической компоненты подверженности сахарному диабету первого типа и хроническому вирусному гепатиту С Аннотация  PDF (Rus)  похожие документы
И. А. Гончарова, Н. В. Тарасенко, А. В. Марков, М. С. Назаренко, Е. В. Белобородова, Е. И. Кондратьева, В. П. Пузырев
"... = 0.004); «TT» of rs1007856 of ITGB5 gene (OR = 1.86(1.20-2.90), p = 0,040); «CC» of rs20579 of LIG1 ..."
 
Том 15, № 5 (2016) Роль регуляторных участков гена CORO2A в формировании наследственной предрасположенности к преэклампсии Аннотация  PDF (Rus)  похожие документы
В. Н. Сереброва, Е. А. Трифонова, В. А. Степанов
"... .Óëàí-Óäý (ÏÝ = 140 ÷åë., êîíòðîëü = 220 ÷åë.), ðóñ- ñêèå èç ã.Òîìñêà (ÏÝ = 158 ÷åë., êîíòðîëü = 210 ÷åë ..."
 
Том 15, № 6 (2016) Роль полиморфных вариантов гена ангиотензин-превращающего фермента (АСЕ) в формировании различных типов ремоделирования миокарда у больных хронической сердечной недостаточностью Аннотация  PDF (Rus)  похожие документы
А. Э. Пушкарева, Р. И. Хусаинова, Р. Р. Валиев, Г. П. Арутюнов, Э. К. Хуснутдинова
"... ,8% (p = 0,017, p = 0,004). Ðèñê ôîðìèðîâàíèÿ ÕÑÍ êàê ñ äèëàòàöèîííûì, òàê è ãèïåðòðîôè÷åñêèì òèïàìè ðå ..."
 
Том 14, № 4 (2015) МАТЕРИАЛЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И МАТЕРИАЛЫ 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... íîíñåíñ ìóòàöèè c.183C>A (p.Tyr61X), c.732C>A (p.Tyr244X) è äâå äåëå- öèè p.Ile158_Pro161del (c.474_485del ..."
 
Том 15, № 3 (2016) Исследование рецессивных форм НМСН у российских больных с использованием новой медицинской технологии «Система детекции в одной пробирке частых мутаций при рецессивных наследственных моторно-сенсорных нейропатиях» Аннотация  PDF (Rus)  похожие документы
О. А. Щагина, Т. Б. Миловидова, М. В. Булах, А. В. Поляков
"... -HCl (pH 7.5), 20 mM KCl, 10 mM MgCl2, 0,1% Igepal, 0,01 mM rATP, 1 mM DTT), 17 ñïåöèôè÷íûõ ïðîá, 0,04 ..."
 
Том 15, № 2 (2016) Генетическая гетерогенность менделирующих заболеваний и ДНК-диагностика Аннотация  PDF (Rus)  похожие документы
А. В. Поляков, О. А. Щагина
"... Ìûøå÷íûå äèñòðîôèè 64 400 000 Êàðäèîìèîïàòèè 176 800 000 Òóãîóõîñòü 96 416 004 Ðèñ. 1. Áåëêè ..."
 
Том 15, № 10 (2016) Сравнение фенотипических проявлений периодической болезни у гетерозиготных носителей мутаций гена MEFV и гомозигот по тем же мутациям Аннотация  PDF (Rus)  похожие документы
А. С. Айрапетян, Т. Ф. Саркисян, С. А. Атоян
"... (38,6%), ïëåâ ðèò ó 24,6% ïà öè åí - òîâ, ìè àë ãèè (15,8%). Ìó òà öèè A744S, K695R ó ïà öè åí - òîâ ..."
 
Том 12, № 3 (2013) «ТЕРРИТОРИАЛЬНЫЙ» ПОДХОД К ОТБОРУ ФАМИЛИЙ ПРИ ПОПУЛЯЦИОННО-ГЕНЕТИЧЕСКОМ ИССЛЕДОВАНИИ НАСЕЛЕНИЯ ЮГА ЦЕНТРАЛЬНОЙ РОССИИ Аннотация  PDF (Rus)  похожие документы
И. Н. Сорокина, Е. Н. Крикун, М. И. Чурносов
"... ,5 13 828 71,4 Âà ëóé ñêèé 74 56 461 7628 5179 67,9 50 845 90,1 3031 39,7 42 174 74,7 Âåé äå ëåâ ñêèé ..."
 
Том 15, № 1 (2016) Полиморфизм гена CHIT1 в популяции абхазов и феномен долгожительства Аннотация  PDF (Rus)  похожие документы
С. В. Макаров, М. К. Карапетян, К. Б. Квеквескири, А. Ю. Асанов, Л. С. Бычковская, В. А. Спицын
"... .E., van Deventer S.J., van der P.T. Activation of mo- nonuclear cells by interleukin-12: an in vivo study ..."
 
Том 14, № 1 (2015) ОПИСАТЕЛЬНАЯ ЭПИДЕМИОЛОГИЯ АТРЕЗИИ ПИЩЕВОДА (ПО ДАННЫМ МОНИТОРИНГА ВПР) Аннотация  PDF (Rus)  похожие документы
Н. С. Демикова, Ю. В. Выдрыч, М. А. Подольная, А. С. Лапина, А. Ю. Асанов
"... ãã. îáùåå ÷èñëî ðîæäåíèé â èçó÷àåìûõ ðåãèîíàõ ñîñòàâèëî 8 124 158. Âñåãî çà ýòî âðåìÿ áûëî ..."
 
Том 14, № 11 (2015) Сравнение репродуктивных параметров и индекса Кроу сельских карачаевцев и черкесов Аннотация  PDF (Rus)  похожие документы
Г. И. Ельчинова, А. Х. Макаов, Р. А. Зинченко
"... ìåäèöèíñêèõ àáîðòîâ 0,59 ± 0,04 0,91 ± 0,05 Òàáëèöà 2 Âîçðàñòíûå ïàðàìåòðû ðåïðîäóêöèè ñåëüñêèõ êàðà÷àåâöåâ è ..."
 
Том 15, № 8 (2016) Полиморфизм генов STAT4 и CTLA4 у населения Беларуси в связи с предрасположенностью к заболеванию ювенильным идиопатическим артритом Аннотация  PDF (Rus)  похожие документы
А. А. Яцкив, Н. В. Никитченко, А. М. Чичко, А. В. Сукало, Р. И. Гончарова
"... = 0,04). Äëÿ âñåõ îñòàëüíûõ ïîäòèïîâ çàáîëåâàíèÿ ðàçëè÷èé â ðàñïðîñòðàíåíèè àëëåëåé ïî îáîèì ïîëè ..."
 
Том 14, № 1 (2015) К ГЕНЕТИЧЕСКОМУ ИССЛЕДОВАНИЮ ФЕНОМЕНА ДОЛГОЖИТЕЛЬСТВА НА ПРИМЕРЕ АНАЛИЗА АБХАЗСКОЙ ПОПУЛЯЦИИ; ПОЛИМОРФИЗМ APOE Аннотация  PDF (Rus)  похожие документы
В. А. Спицын, С. В. Макаров, К. Б. Квеквескири, А. С. Самохин, Л. В. Бец, Л. С. Бычковская, Н. Х. Спицына
"... , apoE3 è apoE4, îòëè÷àþùèåñÿ àìèíîêèñëîò- íûìè îñòàòêàìè â ïîëîæåíèÿõ 112 (Cys112Arg) è 158 (Arg158Cys ..."
 
Том 14, № 11 (2015) Анализ полиморфизма C677T гена MTHFR у женщин с преждевременными родами Аннотация  PDF (Rus)  похожие документы
Н. И. Любчич, К. Т. Бобоев
"... ôóíêöèîíàëüíîãî íîðìàëüíîãî ãåíîòèïà Ñ677Ñ â 1,3 ðàçà ïî ñðàâíåíèþ ñ êîíòðîëåì (�2 = 6,87; ð = 0,004) (òàáë. 2 ..."
 
Том 15, № 5 (2016) Связь генетического разнообразия по полиморфным вариантам генов, ассоциированных с иммунозависимыми фенотипами, с распространенностью инфекционных и паразитарных заболеваний в популяциях человека Аннотация  PDF (Rus)  похожие документы
А. А. Чередниченко, В. А. Степанов, Е. А. Трифонова, К. В. Вагайцева, А. В. Бочарова
"... Ëåéøìà- íèîç Øèñòîñî- ìîç Ñîâîêóï- íîñòü çà- áîëåâàíèé rs1042713 -0,56 -0,50 -0,72 0,28 -0,04 -0 ..."
 
Том 15, № 1 (2016) Исследование роли полиморфных вариантов генов, ответственных за метаболизм глюкокортикостероидов, в развитии бронхиальной астмы Аннотация  PDF (Rus)  похожие документы
Ю. Ю. Федорова, А. С. Карунас, Р. Р. Мурзина, Г. Ф. Гималова, Р. Ф. Гатиятуллин, Э. И. Эткина, Э. К. Хуснутдинова
"... ÎÔÂ1 òàêæå áûëà áîëåå âûñîêîé (52,69%), ïî ñðàâíåíèþ ñ âû- áîðêîé êîíòðîëÿ (ð = 0,04; OR = 1,64; 95%CI ..."
 
Том 15, № 8 (2016) Семейный случай синдрома Вильямса в трех поколениях Аннотация  PDF (Rus)  похожие документы
О. М. Хурс, Н. В. Румянцева, В. Д. Кулак, И. В. Наумчик, О. Л. Зобикова, О. А. Громыко
"... Turkish family. J Pediatr Endocr Met. 2014;27(1-2):153-158. Familial Williams—Beuren syndrome in three ..."
 
Том 15, № 8 (2016) Случай туберозного склероза в Карачаево-Черкессии Аннотация  PDF (Rus)  похожие документы
А. В. Марахонов, А. Х. Макаов, Т. А. Васильева, Е. Л. Дадали, Е. Е. Тимковская, Р. А. Зинченко
"... Dermatol, 2016. 174(6): p. 1184-5. 6. Krueger, D.A., et al., Everolimus for subependymal giant-cell astro ..."
 
Том 14, № 12 (2015) Медико-генетическое обследование населения г.Черкесска Карачаево-Черкесской Республики Аннотация  PDF (Rus)  похожие документы
Р. А. Зинченко, А. Х. Макаов, В. А. Галкина, Е. Л. Дадали, О. В. Хлебникова, Л. К. Михайлова, Н. В. Петрова, Н. Е. Петрина, Т. А. Васильева, А. Н. Петрин, В. В. Стрельников, А. В. Поляков, Е. К. Гинтер
"... ÓÄÊ 575.1: [575.174.15.3+ 575.174.5] Ìåäèêî-ãåíåòè÷åñêîå îáñëåäîâàíèå íàñåëåíèÿ ã.×åðêåññêà Êàðà ..."
 
Том 15, № 5 (2016) Вариабельность генетического дисбаланса по хромосоме 1 в некультивированных клетках миом матки Аннотация  PDF (Rus)  похожие документы
А. С. Кольцова, О. В. Малышева, А. А. Пендина, О. А. Ефимова, А. Н. Каминская, Н. С. Осиновская, И. Ю. Султанов, Н. Ю. Швед, А. В. Тихонов, В. С. Баранов
"... and soft tissue tumors: leiomyoma. Cancer Genet Cy- togenet. 2005;158:1-26. 3. Makinen N, Mehine M ..."
 
Том 15, № 5 (2016) Ассоциации полиморфизма генов TOMM40 и APOE с количественными фенотипами сердечно-сосудистой системы в популяции русских Сибирского региона Аннотация  PDF (Rus)  похожие документы
Р. Р. Салахов, О. А. Макеева, М. В. Голубенко, О. Л. Барбараш, В. П. Пузырев
"... ,19 134,09 ± 16,87 Æåíùèíû rs8106922 ÒÃ, ììîëü/ë AA (67) GA (74) GG (38) 0,036 1,60 ± 0,93 2,00 ± 1,58 ..."
 
Том 15, № 8 (2016) Молекулярная эпидемиология наследственной патологии в десяти популяциях Карачаево-Черкесской Республики Аннотация  PDF (Rus)  похожие документы
А. Х. Макаов, Р. А. Зинченко, О. В. Хлебникова, Л. К. Михайлова, Н. В. Петрова, П. . Гундорова, Н. Е. Петрина, Т. А. Васильева, А. В. Марахонов, Т. А. Адян, А. В. Поляков, Е. К. Гинтер
"... /IVS10-11G>A; R408W/c.664_665delGA; ex5del/IVS1+5G>T; S349P/R158Q), ó ÷åðêåñîâ äâà (IVS10-11g>a/E390G ..."
 
Том 15, № 5 (2016) Оценка прогностической значимости изменения экспрессии генов ABC-транспортеров в процессе неоадъювантной химиотерапии у больных немелкоклеточном раке легкого Аннотация  PDF (Rus)  похожие документы
М. М. Цыганов, И. В. Дерюшева, Е. О. Родионов, М. К. Ибрагимова, С. В. Миллер, Н. В. Литвяков
"... ïîâûøåíèåì ýêñïðåññèè (lonk rank test = 0,02 è 0,04, ñîîòâåòñòâåííî äëÿ ãåíà ABCB1 è ABCC1). Ïîëó÷åííûå íàìè ..."
 
Том 15, № 2 (2016) Результаты использования новой медицинской технологии «Система детекции в одной пробирке частых мутаций генов ATXN1, ATXN2, ATXN3 при спиноцеребеллярных атаксиях» в ДНК-диагностике Аннотация  PDF (Rus)  похожие документы
О. Л. Миронович, Н. М. Галеева, В. В. Забненкова, О. А. Щагина, А. В. Поляков
"... . Neuroepidemiology. 2014;42(3):174-83. 3. Margolis, R.L. Dominant spinocerebellar ataxias: a molecular approach to ..."
 
Том 14, № 10 (2015) Результаты анкетирования родителей больных фенилкетонурией детей. 3. Отношение к пренатальной диагностике фенилкетонурии Аннотация  PDF (Rus)  похожие документы
В. Л. Ижевская, Л. Ю. Иванова, Е. А. Борзов, И. В. Журавлева, Е. К. Гинтер
"... áûëè ãîòîâû ñîõðàíèòü áåðåìåí- íîñòü èëè óêàçûâàëè, ÷òî íå çíàþò, êàêîå ðåøåíèå ïðè- ìóò (r = -0,174, ð ..."
 
1 - 50 из 75 результатов 1 2 > >> 

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)