Preview

Медицинская генетика

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
Том 16, № 5 (2017) Случай генетического дисбаланса по коротким плечам хромосом 8 и 18 у пациентки без выраженных аномалий физического и умственного развития Аннотация  PDF (Rus)  похожие документы
А. А. Пендина, О. А. Ефимова, О. Г. Чиряева, О. В. Малышева, В. С. Дудкина, Л. И. Петрова, П. А. Павлова, А. В. Тихонов, М. И. Крапивин, А. С. Кольцова, С. Е. Парфеньев, Е. А. Серебрякова, Е. С. Шабанова
"... with microduplications in karyotype 45,ХХ,der(8)t(8;18)(p23;p11.3),-18dn of a 28-year old female patient ..."
 
Том 13, № 11 (2014) АНАЛИЗ АЛЛЕЛЬНОГО ДИСБАЛАНСА ПРИ ГЛИОБЛАСТОМЕ: НОВЫЕ ХРОМОСОМНЫЕ УЧАСТКИ ПОТЕРИ ГЕТЕРОЗИГОТНОСТИ И НОВЫЕ ГЕНЫ-КАНДИДАТЫ Аннотация  PDF (Rus)  похожие документы
Е. А. Алексеева, А. С. Танас, Е. В. Прозоренко, А. М. Зайцев, О. Н. Кирсанова, А. Е. Самарин, Д. В. Залетаев, В. В. Стрельников
"... for which allelic imbalance (AI) had never been described in glioblastoma. Two of the eleven loci, 18q11 ..."
 
Том 17, № 6 (2018) Семейная сложная хромосомная перестройка с участием хромосом 2, 3, 18: фенотипические эффекты и значимость комплексного молекулярно-цитогенетического исследования Аннотация  PDF (Rus)  похожие документы
М. Е. Миньженкова, Ж. Г. Маркова, Л. А. Бессонова, Н. В. Шилова
"... that it was not a balanced translocation. A patient had a two derivative chromosomes - der(2), der(18), due to unbalanced ..."
 
Том 17, № 10 (2018) Гоносомные аномалии и CNV, и их диагностика Аннотация  похожие документы
В. Б. Черных
"... with abnormalities of sex development, physical and mental development, reproductive function. The article provides ..."
 
Том 15, № 5 (2016) Вариабельность генетического дисбаланса по хромосоме 1 в некультивированных клетках миом матки Аннотация  PDF (Rus)  похожие документы
А. С. Кольцова, О. В. Малышева, А. А. Пендина, О. А. Ефимова, А. Н. Каминская, Н. С. Осиновская, И. Ю. Султанов, Н. Ю. Швед, А. В. Тихонов, В. С. Баранов
"... Introduction: The study of genetic imbalance in uterine leiomyoma cells is important ..."
 
Том 17, № 1 (2018) Аутосомные реципрокные транслокации: пренатальная селекция, сегрегация и оценка эмпирического риска рождения жизнеспособного ребенка с хромосомным дисбалансом при семейном носительстве Аннотация  PDF (Rus)  похожие документы
Н. В. Шилова
"... in gametes with chromosome imbalance. An accurate estimate of the probability of this event is understandably ..."
 
Том 14, № 11 (2015) Редкий хромосомный дисбаланс у плода: опыт применения метода чиповой сравнительной геномной гибридизации (aCGH) (клиническое наблюдение) Аннотация  PDF (Rus)  похожие документы
Н. А. Каретникова, А. Н. Екимов, Е. Е. Баранова, В. А. Бахарев, Д. Ю. Трофимов, А. И. Гус
"... .3). Rare chromosomal imbalance in the fetus: the experience of the application of array comparative genomic ..."
 
Том 17, № 10 (2018) Интерпретация клинически значимых вариаций числа копий ДНК Аннотация  похожие документы
Н. В. Шилова, М. Е. Миньженкова
"... of metaphase chromosomes and hence, the mechanism causing the chromosomal imbalance cannot be identified ..."
 
Том 15, № 4 (2016) Микродупликация 12q24.12 у пациента с фармакорезистентной эпилепсией и задержкой развития Аннотация  PDF (Rus)  похожие документы
Е. О. Беляева, Л. П. Назаренко, А. А. Кашеварова, Н. Н. Скрябин, И. Н. Лебедев
"... microduplication at 12q24.12 of maternal origin was detected by aCGH. Patient has marked physical and mental ..."
 
Том 17, № 2 (2018) Интерхромосомная и интрахромосомная инсерции с участием хромосомы 2 Аннотация  PDF (Rus)  похожие документы
М. Е. Миньженкова, Ж. Г. Маркова, Е. Л. Дадали, Н. В. Шилова
"... karyotype as 46,XY,der(2)ins(2;7)(q35;q31.33q34)pat. In case 2 patient with neonatal seizures was referred ..."
 
Том 14, № 5 (2015) ПРИМЕНЕНИЕ МЕТОДА МИКРОМАТРИЧНОЙ СРАВНИТЕЛЬНОЙ ГЕНОМНОЙ ГИБРИДИЗАЦИИ В ПРЕНАТАЛЬНОЙ ДИАГНОСТИКЕ Аннотация  PDF (Rus)  похожие документы
Н. А. Каретникова, А. Н. Екимов, Е. Е. Баранова, В. А. Бахарев, Д. Ю. Трофимов, А. И. Гус
"... . Â ãðóïïå ñðàâíåíèÿ ó ïëîäà æåíùèíû-íîñèòåëüíèöû ðîáåðòñîíîâñêîé òðàíñëîêàöèè 45,ÕÕ,der(13;14);(q10;q ..."
 
Том 15, № 5 (2016) Метилирование гена липазы PNPLA2 при атеросклерозе Аннотация  PDF (Rus)  похожие документы
А. В. Марков, М. С. Назаренко, Е. О. Чуркин, О. Л. Барбараш, В. П. Пузырев
"... One of the key components in the development of atherosclerosis is the metabolic imbalance ..."
 
Том 17, № 2 (2018) Влияние инактивации Х-хромосомы на фенотипические проявления транслокаций Х;аутосома Аннотация  PDF (Rus)  похожие документы
Е. Н. Толмачёва, Н. А. Скрябин, Г. Н. Сеитова, Н. Н. Суханова, А. Д. Черемных, Л. П. Назаренко, И. Н. Лебедев
"... of an unbalanced translocation 46,X,t(X;3)(p11.3;q21.3), the X-chromosome inactivation has a protective effect ..."
 
Том 17, № 3 (2018) Аrray-CGH в диагностике геномных болезней у детей с врожденными пороками сердца и экстракардиальной патологией Аннотация  PDF (Rus)  похожие документы
А. А. Слепухина, Н. А. Скрябин, А. А. Кашеварова, М. А. Новикова, Г. И. Лифшиц, И. Н. Лебедев
"... in detecting genomic imbalance in children with CHD and extracardiac pathology. ..."
 
Том 17, № 11 (2018) CNVs в нозологической структуре врожденных пороков сердца Аннотация  похожие документы
А. А. Слепухина, Н. А. Скрябин, А. А. Кашеварова, Г. И. Лифшиц, И. Н. Лебедев
"... for improving the diagnosis of genomic imbalance in patients with CHD. This study aim at investigating ..."
 
Том 17, № 12 (2018) Нонсенс-мутация GLN1233* и заменa ARG326GLN в гене MYBPC3 у пациентов с гипертрофической кардиомиопатией в Беларуси Аннотация  похожие документы
Н. Н. Чакова, С. С. Ниязова, С. М. Комиссарова, М. А. Сасинович, М. Г. Гончаренко
"... method in all carriers of р.Arg326Gln , and in 113 individuals without the substitution. In those ..."
 
Том 15, № 5 (2016) Информативность бластоцентеза в оценке хромосомного мозаицизма на стадии бластоцисты Аннотация  PDF (Rus)  похожие документы
Н. А. Скрябин, Д. И. Жигалина, В. Г. Артюхова, А. В. Светлаков, И. Н. Лебедев
"... ,19) ish cgh enh(3,X), dim (17,19,21) ish cgh enh(14,17,19,21), dim(1,13) 9 ish cgh (1-22) õ 2,(XY) õ 1 ..."
 
Том 14, № 4 (2015) ТЕЗИСЫ ВСЕРОССИЙСКОЙ НАУЧНО-ПРАКТИЧЕСКОЙ КОНФЕРЕНЦИИ «ПРЕНАТАЛЬНАЯ ДИАГНОСТИКА НАСЛЕДСТВЕННЫХ И ВРОЖДЕННЫХ ЗАБОЛЕВАНИЙ: НАСТОЯЩЕЕ И БУДУЩЕЕ», САНКТ-ПЕТЕРБУРГ, 22—23 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... çàáîëåâàíèé ó ïëîäîâ 27 26 26 47 17 61 204 53 73 78 % âûÿâëÿåìîñòè 6,8 26,3 8,3 16,0 5,4 15,2 11,3% 10,7 12 ..."
 
Том 12, № 2 (2013) ВЛИЯНИЕ ГЕНЕТИЧЕСКИХ ФАКТОРОВ ЧЕЛОВЕКА НА ВЫСОКОАКТИВНУЮ АНТИРЕТРОВИРУСНУЮ ТЕРАПИЮ (ВААРТ) Аннотация  PDF (Rus)  похожие документы
А. С. Туманов
"... . — 2011. — Vol. 4. — P. 69—90. 3. An der son K.S. A tran si ent ki ne tic ap pro ach to in ves ti ga te ..."
 
Том 15, № 9 (2016) Генная терапия наследственных заболеваний с использованием технологии CRISPR/Cas9 in vivo Аннотация  PDF (Rus)  похожие документы
С. А. Смирнихина, А. В. Лавров
"... . Sustained expression from DNA vectors. Adv Genet. 2015;89:113-152. 9. Videira M, Arranja A, Rafael D ..."
 
Том 15, № 7 (2016) Биомаркеры в диагностике и мониторинге лечения болезней клеточных органелл Аннотация  PDF (Rus)  похожие документы
Т. Д. Крылова, Т. Ю. Прошлякова, Г. В. Байдакова, Ю. С. Иткис, М. В. Куркина, Е. Ю. Захарова
"... : progress with enzyme replacement therapy. Drugs. 2007; 67: 2697-2716. 11. Smid BE, van der Tol L ..."
 
Том 15, № 10 (2016) Сравнение фенотипических проявлений периодической болезни у гетерозиготных носителей мутаций гена MEFV и гомозигот по тем же мутациям Аннотация  PDF (Rus)  похожие документы
А. С. Айрапетян, Т. Ф. Саркисян, С. А. Атоян
"... ,001 Àð ò ðèò 341 23,8 754 36,9 67,3 p<0,001 Àð ò ðàë ãèÿ 610 42,5 1243 60,8 113,4 p<0,001 Ìè àë ãèÿ 494 ..."
 
Том 15, № 1 (2016) Полиморфизм гена CHIT1 в популяции абхазов и феномен долгожительства Аннотация  PDF (Rus)  похожие документы
С. В. Макаров, М. К. Карапетян, К. Б. Квеквескири, А. Ю. Асанов, Л. С. Бычковская, В. А. Спицын
"... .E., van Deventer S.J., van der P.T. Activation of mo- nonuclear cells by interleukin-12: an in vivo study ..."
 
Том 15, № 1 (2016) Генетика мигрени Аннотация  PDF (Rus)  похожие документы
Н. С. Кондратьева, А. А. Анучина, З. Г. Кокаева, Е. А. Наумова, Ю. Э. Азимова, А. В. Сергеев, К. В. Скоробогатых, Г. Р. Табеева, Е. А. Климов
"... (Chinese Han) [113]. Â òî æå âðåìÿ, àññî- öèàöèÿ ñ ãåíàìè LRP1 è TRPM8 áûëà îáíàðóæåíà â Äà- íèè è Èñëàíäèè ..."
 
Том 16, № 2 (2017) Роль полиморфных вариантов генов NO-синтаз и аргиназы при бронхиальной астме у детей Аннотация  PDF (Rus)  похожие документы
Б. Ц. Батожаргалова, Ю. Л. Мизерницкий, С. Э. Дьякова, Н. В. Петрова, Р. А. Зинченко
"... girls. Gen der dif fer ences were re vealed. Sig nif i cant gene-gene in ter ac tions of poly mor phic ..."
 
Том 14, № 10 (2015) Полиморфизм генов системы эндотелина-1 и риск эссенциальной гипертензии Аннотация  PDF (Rus)  похожие документы
Я. Р. Тимашева, Т. Р. Насибуллин, Э. Б. Имаева, Г. Х. Мирсаева, О. Е. Мустафина
"... dependent on physical activity or fitness levels // Hyper- tension. — 2007. — Vol. 50, ¹ 6. — P. 1120—1125 ..."
 
Том 15, № 5 (2016) Роль полиморфизма генов IL1b (+3953)С/Т и IL8 (-251)А/Т в развитии Н. pylori-ассоциированного хронического гастрита Аннотация  PDF (Rus)  похожие документы
Ю. В. Саранчина, Е. С. Агеева, О. В. Штыгашева, В. М. Иптышев
"... çàáîëåâàíèè ëåãêèõ. Âåñòíèê ÊÐÑÓ. 2012;12(1):110-113. 8. Ìàâðîâ ÃÈ, Íàãîðíûé ÀÅ.Èììóííûå íàðóøåíèÿ ïðè ..."
 
Том 12, № 2 (2013) АССОЦИАЦИЯ ГЕНОВ ТР53 И MDM2 С РИСКОМ РАЗВИТИЯ РАКА МОЛОЧНОЙ ЖЕЛЕЗЫ У РУССКИХ ЖЕНЩИН МОСКОВСКОГО РЕГИОНА Аннотация  PDF (Rus)  похожие документы
А. М. Бурденный, Т. П. Казубская, Э. А. Брага, В. В. Носиков, В. И. Логинов
"... ., Le vi ne A.J. MDM2 T309G ac ce le ra tes tu - mor for ma ti on in a gen der-spe ci fic and hor mo ne ..."
 
Том 13, № 11 (2014) МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ АСПЕКТЫ ЯЗВЕННОЙ БОЛЕЗНИ Аннотация  PDF (Rus)  похожие документы
Э. Х. Шаймарданова, А. Х. Нургалиева, Д. Д. Надыршина, Э. К. Хуснутдинова
"... èíãèáèòîðîâ (TIMP) [50, 58, 106, 113]; ãåíû, êîäèðóþ- ùèå ôåðìåíòû, ó÷àñòâóþùèå â ïðîöåññàõ ïèùåâàðåíèÿ (PGCC ..."
 
Том 14, № 11 (2015) Исследование полиморфизма гена IL-1B у детей с фебрильными приступами Аннотация  PDF (Rus)  похожие документы
М. А. Строганова, Н. А. Шнайдер, Г. П. Мартынова, Д. В. Дмитренко, Н. В. Терскова, К. А. Газенкампф, Ю. Б. Говорина, А. В. Дюжакова
"... (24,2%) 0 (0,0%) 13 (20,9%) 10 (16,1%) 0 (0,0%) 0 (0,0%) 0 (0,0%) 7 (11,3%) Äåòè áåç ÔÏ (n2 ..."
 
Том 15, № 4 (2016) Ассоциация полиморфного варианта сайта связывания микроРНК rs10491534 гена TSC1 с тяжестью течения рака почки Аннотация  PDF (Rus)  похожие документы
Е. А. Климентова, И. Р. Гилязова, Г. Б. Кунсбаева, А. А. Измайлов, И. М. Султанов, В. Н. Павлов, Э. К. Хуснутдинова
"... ,94 ± 1,7 (4,92-11,99) 52 9,42 ± 1,24 (7,12-12,17) T 113 63,48 ± 3,61 (55,95-70,56) 232 92,06 ± 1,7 (88 ..."
 
Том 14, № 5 (2015) ОСОБЕННОСТИ РАСПРЕДЕЛЕНИЯ ПОЛИМОРФИЗМА ГЕНОВ ACE, CHIT1, PON1, SIRT1 И NOS3 У БОЛЬНЫХ ВИБРАЦИОННОЙ БОЛЕЗНЬЮ* Аннотация  PDF (Rus)  похожие документы
В. А. Спицын, Л. П. Кузьмина, С. В. Макаров, М. К. Карапетян, М. В. Попова, Л. С. Бычковская, А. С. Самохин, Н. Х. Спицына
"... ïîëèìîðôèçìîâ â ãåíå ñèðòóèíà-1 (SIRT1) [20]. Îêàçàëîñü, ÷òî òîëüêî 4 èç 113 ïîëèìîð- ôèçìîâ îïðåäåëÿþò ..."
 
Том 12, № 4 (2013) ЭКСПРЕССИЯ ГЕНОВ ЦИРКАДНОГО РИТМА CLOCK, BMAL1 И PER1 В КЛЕТКАХ БУККАЛЬНОГО ЭПИТЕЛИЯ У БОЛЬНЫХ ЭССЕНЦИАЛЬНОЙ АРТЕРИАЛЬНОЙ ГИПЕРТЕНЗИЕЙ Аннотация  PDF (Rus)  похожие документы
И. В. Курбатова, Л. В. Топчиева, В. А. Корнева, С. Н. Коломейчук, Н. Н. Немова
"... der E., Edel mann S.E., Hug hes M.E., Kor nac ker K., Bal ke C.W., Es ser K.A. Age-as so ci a ted dis ..."
 
Том 15, № 12 (2016) Оксистеролы в дифференциальной диагностике лизосомных болезней накопления Аннотация  PDF (Rus)  похожие документы
Т. Ю. Прошлякова, Г. В. Байдакова, Е. А. Каменец, С. В. Михайлова, В. А. Малахова, Е. Ю. Захарова
"... . 2011; (52): 1435-1445. 11. Kant R. van der, Zon der van I, Jans sen L, Ne ef jes J. Cho les - te rol ..."
 
Том 15, № 8 (2016) Оптимизация условий трансфекции клеточной культуры CFTE29o- для разработки редактирования мутации F508del в гене CFTR Аннотация  PDF (Rus)  похожие документы
С. А. Смирнихина, А. В. Банников, А. В. Лавров
"... Med Chem Lett. 2015 Mar 15;25(6):1171-1176. 10. Graham FL, van der Eb AJ. A new technique for the ..."
 
Том 12, № 4 (2013) ГЕНЕТИЧЕСКИЕ ОСНОВЫ ГЕМИПЛЕГИЧЕСКОЙ МИГРЕНИ Аннотация  PDF (Rus)  похожие документы
Ю. Э. Азимова, Е. А. Климов, К. В. Скоробогатых, А. В. Сергеев, З. Г. Кокаева, Г. Р. Табеева
"... // Ann. Ne u - rol. — 1996. — Vol. 39. — P. 100—106. 18. Erik sen M.K., Thom sen L.L., An der sen I. et ..."
 
Том 12, № 2 (2013) МЕЗОМЕЛИЧЕСКАЯ ДИСПЛАЗИЯ С ПРЕАКСИАЛЬНОЙ ПОЛИДАКТИЛИЕЙ ВЕРНЕРА, ОБУСЛОВЛЕННАЯ МУТАЦИЕЙ В РЕГУЛЯТОРНОМ ЭЛЕМЕНТЕ ZRS ГЕНА SHH Аннотация  PDF (Rus)  похожие документы
В. П. Федотов, Н. М. Галеева, А. В. Поляков
"... ) Whi le Com p - le te ZRS Dup li ca ti ons Un der lie Ha as Ty pe Po ly syn dac ty ly and Pre - a xi ..."
 
Том 15, № 4 (2016) Молекулярное кариотипирование при недифференцированных формах интеллектуальных расстройств: от хромосомных мутаций к идентификации патогенетически значимых генов Аннотация  PDF (Rus)  похожие документы
А. А. Кашеварова, Н. А. Скрябин, М. Е. Лопаткина, О. А. Салюкова, М. Н. Филимонова, О. В. Лежнина, А. Р. Шорина, А. Б. Масленников, Л. П. Назаренко, V. . Culic, И. Н. Лебедев
"... , ABHD4 28 arr[hg18]17q21.31(41,587,723-41,700,815) x 3 0,113 KANSL1 29 arr[hg18]12q24.12(110,668,504-110 ..."
 
Том 14, № 5 (2015) ВОЗМОЖНОСТЬ ОЦЕНКИ ЭФФЕКТИВНОСТИ МЕДИКО-ГЕНЕТИЧЕСКОГО КОНСУЛЬТИРОВАНИЯ. ОБЗОР ЛИТЕРАТУРЫ Аннотация  PDF (Rus)  похожие документы
Е. Е. Баранова, Л. Ю. Иванова, И. В. Журавлева, В. Л. Ижевская, Е. К. Гинтер
"... hypercholesterolemia: a qualitative interview study // Patient Educ. Couns. — 2007. — Vol. 69(1—3). — P. 108—113. 22 ..."
 
Том 12, № 2 (2013) ПОЛИМОРФИЗМ C677TГЕНА MTHFR И РИСК ФОРМИРОВАНИЯ НЕСИНДРОМАЛЬНЫХ ОРОФАЦИАЛЬНЫХ РАСЩЕЛИН Аннотация  PDF (Rus)  похожие документы
Т. И. Мещерякова, С. И. Маркова, С. С. Жилина, Г. В. Гончаков, С. Г. Гончакова, А. А. Абрамов, А. Н. Петрин, Г. Р. Мутовин
"... —113. 9. Goy et te P., Sum ner J.S., Mi los R. et al. Hu man met hy le ne - tet ra hyd ro fo la te re ..."
 
Том 16, № 2 (2017) Фенотипические проявления митохондриальных заболеваний, обусловленных мутациями в гене SCO2 Аннотация  PDF (Rus)  похожие документы
Ю. С. Иткис, И. О. Бычков, С. В. Михайлова, Е. С. Ильина, В. В. Никитин, Л. М. Колпакчи, И. Д. Федонюк, Е. И. Зотина, Н. А. Пичкур, П. Г. Цыганкова, Е. Ю. Захарова
"... . Le igh syn d ro me: One di sor der, mo re than 75 mo no ge nic ca u ses. Ann Ne u - rol. 2015;79(2 ..."
 
Том 16, № 1 (2017) Анализ генов цитокиновой сети в развитии «обратной» коморбидности для бронхиальной астмы и туберкулеза Аннотация  PDF (Rus)  похожие документы
Е. Ю. Брагина, М. Б. Фрейдин, Н. П. Бабушкина, А. Ф. Гараева, О. В. Колоколова, И. Ж. Жалсанова, В. П. Пузырев
"... òó ðû 1. Ja cob L, Breu er J, Kos tev K. Pre va len ce of chro nic di se a ses among ol der pa ti ..."
 
Том 14, № 3 (2015) ТЕЗИСЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... (der(18)t(8;18). Ñ ïîìîùüþ ìåòîäà ìèêðîäèññåêöèè è òðåõìåð- íîé, ñóñïåíçèîííîé ãèáðèäèçàöèè in situ (S ..."
 
Том 15, № 6 (2016) Роль полиморфных вариантов гена ангиотензин-превращающего фермента (АСЕ) в формировании различных типов ремоделирования миокарда у больных хронической сердечной недостаточностью Аннотация  PDF (Rus)  похожие документы
А. Э. Пушкарева, Р. И. Хусаинова, Р. Р. Валиев, Г. П. Арутюнов, Э. К. Хуснутдинова
"... . — P. 755—757. 2. Der Sarkissan S., Huentelman M.J., Sterwart J., Kato- vich M.J., Raizada M.K. ACE2 ..."
 
Том 14, № 12 (2015) Ассоциация полиморфного маркера G276Т гена адипонектина с сахарным диабетом типа 2 в кыргызской популяции Аннотация  PDF (Rus)  похожие документы
Ж. Т. Исакова, Э. Т. Талайбекова, Д. А. Асамбаева, А. С. Керимкулова, О. С. Лунегова, А. А. Алдашев
"... glucose // Endocrine — 2014. — Vol. 47. — P. 749—757. 20. Qiao L., Zou C., van der Westhuyzen D.R., Shao ..."
 
Том 12, № 1 (2013) МЕДИКО-ГЕНЕТИЧЕСКОЕ ИЗУЧЕНИЕ НАСЕЛЕНИЯ ТАТАРСТАНА. СООБЩЕНИЕ 4. ГАМЕТНЫЙ ИНДЕКС Аннотация  PDF (Rus)  похожие документы
Г. И. Ельчинова, Л. А. Эльканова, Т. А. Васильева, Р. А. Зинченко
"... Med i cal Ge net ics» un der Rus sian Acad emy of Med i cal Sci ence, Ìîscow 115478, e-mail ..."
 
Том 12, № 4 (2013) ВАРИАБЕЛЬНОСТЬ ГЕНОВ ИНТЕРЛЕЙКИНА 4 И ЕГО РЕЦЕПТОРА В ПОПУЛЯЦИЯХ КОРЕННЫХ НАРОДОВ СИБИРИ Аннотация  PDF (Rus)  похожие документы
В. А. Степанов, Е. А. Трифонова, К. В. Симонова, А. А. Чередниченко
"... and Khant). In the pop u la tions un der study, ex cept Khants, the close spec trum of al lele fre ..."
 
Том 15, № 12 (2016) Молекулярная патология хромосомного района 10q23.3-26.3 при глиобластоме Аннотация  PDF (Rus)  похожие документы
Е. А. Алексеева, А. С. Танас, Е. В. Прозоренко, А. М. Зайцев, М. И. Куржупов, О. Н. Кирсанова, В. В. Руденко, Д. В. Залетаев, В. В. Стрельников
"... : GCAGTGAGTCATGATCACGC R: AGGTGGTGTGCAAGATGACA 64 135 D10S169 F: GATCTGTGACTGCCTTCCT R: AAGAGGAGGAGTCCATTCAG 62 113 ..."
 
Том 15, № 1 (2016) Исследование роли полиморфных вариантов генов, ответственных за метаболизм глюкокортикостероидов, в развитии бронхиальной астмы Аннотация  PDF (Rus)  похожие документы
Ю. Ю. Федорова, А. С. Карунас, Р. Р. Мурзина, Г. Ф. Гималова, Р. Ф. Гатиятуллин, Э. И. Эткина, Э. К. Хуснутдинова
"... ,0) ÌÎÑ50 CC 107 62,0 (41,0; 91,0) 7,37 (0,03) CG 117 55,0 (32,50; 84,0) GG 26 90,0 (44,75; 113 ..."
 
Том 14, № 11 (2015) Спектр мутаций при аутосомно-рецессивном врожденном ихтиозе у больных в Российской Федерации Аннотация  PDF (Rus)  похожие документы
Н. Н. Вассерман, Г. М. Баязутдинова, С. И. Браславская, Н. В. Ряднинская, А. Л. Чухрова, А. В. Поляков
"... chromosome 17p13.1 // Hum. Mol. Genet. — 2002. — Vol. 11, ¹ 1. — P. 107—113. 7. Kelsell D.P., Norgett E ..."
 
1 - 50 из 79 результатов 1 2 > >> 

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)