Preview

Медицинская генетика

Расширенный поиск

Поиск


Сортировать по:     
 
Выпуск Название
 
Том 17, № 6 (2018) Редкий случай семейного аденоматозного полипоза Аннотация  PDF (Rus)  похожие документы
Т. А. Музаффарова, Д. Ж. Мансорунов, Ф. М. Кипкеева, А. А. Алимов, А. В. Карпухин
"... При обследовании больных с множественными полипами толстой кишки был выявлен редкий случай ..."
 
Том 14, № 10 (2015) Определение функциональной значимости варианта c.423-6A>G в гене APC у пациента с клиническими признаками семейного аденоматоза толстой кишки Аннотация  PDF (Rus)  похожие документы
А. С. Цуканов, Н. И. Поспехова, В. П. Шубин, А. М. Кузьминов, И. Ю. Сачков, В. Н. Кашников, С. А. Фролов, Ю. А. Шелыгин
"... До 1% всех случаев колоректального рака возникает на фоне семейного аденоматоза толстой кишки. Этот ..."
 
Том 16, № 2 (2017) Синдром Линча. Современное состояние проблемы Аннотация  PDF (Rus)  похожие документы
А. С. Цуканов, Ю. А. Шелыгин, Д. А. Семенов, Д. Ю. Пикунов, А. В. Поляков
"... репарации неспаренных оснований ДНК, обусловливающий высокий риск развития рака толстой кишки, а также ..."
 
Том 18, № 1 (2019) Новый вариант р.Cys3024Tyr и частые мутации в гене PKHD1, выявленные в семьях с аутосомно-рецессивной поликистозной болезнью почек в Российской Федерации Аннотация  похожие документы
Н. Н. Вассерман, А. В. Поляков
"... 12.7% mutations. This variant did not found on 1008 control chromosomes. Mutation c.107C>T (р.Thr36 ..."
 
Том 13, № 11 (2014) МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ АСПЕКТЫ ЯЗВЕННОЙ БОЛЕЗНИ Аннотация  PDF (Rus)  похожие документы
Э. Х. Шаймарданова, А. Х. Нургалиева, Д. Д. Надыршина, Э. К. Хуснутдинова
"... клинической картиной и изъязвлением слизистой оболочки желудка и/или двенадцатиперстной кишки (ДПК) в периоды ..."
 
Том 14, № 10 (2015) Клинический случай новой мутации в гене GDAP1 в семье с наследственной моторно-сенсорной нейропатией 2К Аннотация  PDF (Rus)  похожие документы
Е. В. Сайфуллина, И. М. Хидиятова, Р. В. Магжанов, И. А. Скачкова, Э. К. Хуснутдинова
"... motor and sensory neuropathy (HMSN) due to the new mutation in the GDAP1 gene: s.934G> A (p.Ala312Thr ..."
 
Том 13, № 11 (2014) МЕДИКО-ГЕНЕТИЧЕСКОЕ ИЗУЧЕНИЕ НАСЕЛЕНИЯ РЕСПУБЛИКИ ТАТАРСТАН. VII. РАЗНООБРАЗИЕ НАСЛЕДСТВЕННОЙ ПАТОЛОГИИ В ВОСЬМИ РАЙОНАХ Аннотация  PDF (Rus)  похожие документы
Р. А. Зинченко, В. А. Галкина, Е. Л. Дадали, О. В. Хлебникова, Л. К. Михайлова, В. В. Кадышев, С. Г. Гаврилина, А. Н. Петрин, Г. И. Ельчинова, А. В. Поляков, В. В. Стрельников, Д. В. Залетаев, Т. А. Васильева, Н. В. Петрова, Н. Е. Петрина, Е. Ю. Захарова, Л. А. Бессонова, Е. К. Гинтер
"... of the Republic of Tatarstan (RT) is reviewed. The number of the investigation population was 264,310 people ..."
 
Том 15, № 8 (2016) Клинический случай поздней диагностики мышечной дистрофии Эмери-Дрейфуса, ассоциированной с мутацией в гене LMNA Аннотация  PDF (Rus)  похожие документы
Л. Н. Сивицкая, Т. Г. Вайханская, Н. Г. Даниленко, Т. В. Курушко, О. Г. Давыденко
"... heterozygous mutation с.1247С>G ( Thr528Arg , rs57629361, NM_001257374.2) in exon 9. The mutation was not found ..."
 
Том 12, № 2 (2013) SEMA6B — КАНДИДАТ НА РОЛЬ ГЕНА СУПРЕССОРА ОПУХОЛЕВОГО РОСТА В КРИТИЧЕСКОМ ХРОМОСОМНОМ РАЙОНЕ 19Р13.3 Аннотация  PDF (Rus)  похожие документы
Е. Б. Кузнецова, Е. А. Пудова, А. С. Танас, Д. В. Залетаев, В. В. Стрельников
"... злокачественных новообразований: при раке ободочной кишки, шейки матки, молочной железы, при миелоидном лейкозе ..."
 
Том 17, № 10 (2018) Врожденный миастенический синдром с дыхательной недостаточностью, тип 20 Аннотация  PDF (Rus)  похожие документы
Т. В. Кожанова, С. С. Жилина, Т. И. Мещерякова, М. Ю. Шорина, И. Ф. Деменьшин, Г. Г. Прокопьев, А. Г. Притыко
"... in the 6 exon of the SLC5A7 gene (p.Ile291Thr) was detected by whole-exome sequencing. This mutation ..."
 
Том 15, № 12 (2016) Генетические маркеры фиброгенеза при хроническом вирусном гепатите С Аннотация  PDF (Rus)  похожие документы
И. А. Гончарова, М. С. Назаренко, Н. В. Тарасенко, А. В. Марков, Е. В. Белобородова, В. П. Пузырев
"... ,89, 95%CI: 1,16-3,10; p = 0,009). Therefore, in susceptibility to chronic HCV contribute genes ..."
 
Том 13, № 11 (2014) ИЗУЧЕНИЕ НАСЛЕДСТВЕННЫХ ФОРМ ТУГОУХОСТИ / ГЛУХОТЫ В РЕСПУБЛИКЕ ТЫВА. СООБЩЕНИЕ II. ОЦЕНКА СПЕКТРА МУТАЦИЙ В ГЕНЕGJB2 (CX26) И ИХ ВКЛАДА В ЭТИОЛОГИЮ ПОТЕРИ СЛУХА Аннотация  PDF (Rus)  похожие документы
М. С. Бады-Хоо, А. А. Бондарь, И. В. Морозов, М. В. Зыцарь, В. Ю. Михальская, О. В. Скиданова, Н. А. Барашков, Р. Ш. Монгуш, О. С. Омзар, В. М. Тукар, О. Л. Посух
"... ) was 11.57% (p.W172C — 4.96%, IVS1 +1 G>A — 4.13%, p.V37I — 2.48%, respectively). We detected GJB2 ..."
 
Том 14, № 12 (2015) Аллельный полиморфизм генов, ассоциированных с активностью плазменного звена гемостаза, и риск венозного тромбоэмболизма у лиц молодого возраста Аннотация  PDF (Rus)  похожие документы
А. В. Демьяненко, С. И. Капустин, В. В. Сорока, П. В. Чечулов
"... ) - 455 G/A, FI a-subunit Thr312Ala, FII 20210 G/A, FV 1691 G/A, FXII 46 C/T, FXIII A-subunit Val34Leu ..."
 
Том 12, № 4 (2013) ГЕНЕТИЧЕСКИЕ ОСНОВЫ ГЕМИПЛЕГИЧЕСКОЙ МИГРЕНИ Аннотация  PDF (Rus)  похожие документы
Ю. Э. Азимова, Е. А. Климов, К. В. Скоробогатых, А. В. Сергеев, З. Г. Кокаева, Г. Р. Табеева
"... Thr666Met (äà ëåå áó äóò óêà çû âà òü - ñÿ ïî ëî æå íèÿ çà ìå íû â àìè íî êèñ ëîò íîé ïî ñëå äî âà òå ..."
 
Том 14, № 4 (2015) ТЕЗИСЫ ВСЕРОССИЙСКОЙ НАУЧНО-ПРАКТИЧЕСКОЙ КОНФЕРЕНЦИИ «ПРЕНАТАЛЬНАЯ ДИАГНОСТИКА НАСЛЕДСТВЕННЫХ И ВРОЖДЕННЫХ ЗАБОЛЕВАНИЙ: НАСТОЯЩЕЕ И БУДУЩЕЕ», САНКТ-ПЕТЕРБУРГ, 22—23 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... âîðñèí õîðèîíà ìåòîäîì MLPA íà ñåêâåíàòîðå AB PRISM 310 íàáîðàìè ôèðìû MRC Holland (Ãîëëàíäèÿ) ïî ..."
 
Том 15, № 9 (2016) Молекулярно-генетическая и биохимическая характеристика изолированной метилмалоновой ацидурии у российских пациентов Аннотация  PDF (Rus)  похожие документы
М. В. Куркина, Г. В. Байдакова, Е. Ю. Захарова
"... _595delACTG (p.Thr198Serfs*6), c.433C>T (p.Arg145*), ñ.266T>C (p.Leu89Pro). Ìóòàöèÿ ñ.266T>C (p.Leu89Pro) áûëà ..."
 
Том 15, № 2 (2016) Результаты использования новой медицинской технологии «Система детекции наиболее частых мутаций гена FGFR3, ответственного за ахондроплазию и гипохондроплазию» в ДНК-диагностике Аннотация  PDF (Rus)  похожие документы
Н. Н. Вассерман, О. А. Щагина, А. В. Поляков
"... Asn540Thr (c.1619A>C) [7]. Ïîêàçàíî, ÷òî ïðè÷èíîé 80% ñëó÷àåâ äàííûõ áîëåçíåé ÿâëÿþòñÿ ìóòàöèè de novo ..."
 
Том 15, № 5 (2016) Новый метод молекулярно-генетической диагностики стероидрезистентного нефротического синдрома Аннотация  PDF (Rus)  похожие документы
Д. Г. Сладков, К. В. Савостьянов, А. Н. Цыгин, А. А. Пушков, И. С. Жанин, А. Г. Никитин, А. В. Пахомов, П. В. Ананьин
"... .Arg558Leu) PLCE1 c.3346C>T (p.Arg1116X); c.1405T>A (p.Ser469Thr); c.5738G>A (p.Arg1913Gln) ACTN4 c.682T ..."
 
Том 15, № 4 (2016) Взаимоотношения популяций мира по SNP маркерам Х-хромосомы, входящим в состав тест-системы для ДНК-идентификации XSNPid Аннотация  PDF (Rus)  похожие документы
К. В. Вагайцева, В. Н. Харьков, В. А. Степанов
"... êîðåííîãî íàñåëåíèÿ Ñèáèðè. Ãå- íåòèêà. 2016; 52(4):493-496. 10. Stepanov V, Vagaitseva K, Kharkov V, et al ..."
 
Том 14, № 5 (2015) ОСОБЕННОСТИ РАСПРЕДЕЛЕНИЯ ПОЛИМОРФИЗМА ГЕНОВ ACE, CHIT1, PON1, SIRT1 И NOS3 У БОЛЬНЫХ ВИБРАЦИОННОЙ БОЛЕЗНЬЮ* Аннотация  PDF (Rus)  похожие документы
В. А. Спицын, Л. П. Кузьмина, С. В. Макаров, М. К. Карапетян, М. В. Попова, Л. С. Бычковская, А. С. Самохин, Н. Х. Спицына
"... ÷åñêè çíà÷èìî ïðåîáëàäàåò ãîìîçèãîòûé ãåíîòèï ACE DD (37,5%) ïðè äåôèöèòå ãåòåðîçèãîò ACE ID (49,6%).  ..."
 
Том 15, № 10 (2016) Гены BRCA1 и BRCA2: популяционные особенности развития рака молочной железы у татарских женщин Аннотация  PDF (Rus)  похожие документы
О. И. Бровкина, М. Г. Гордиев, Л. Х. Шигапова, М. О. Дружков, Е. И. Шагимарданова, Р. Ф. Еникеев, Д. С. Ходырев, О. А. Гусев, А. Г. Никитин
"... :32912181 NM_000059.3:c.3689C>T p.Ser1230Phe 1 BRCA2 chr13:32930673 NM_000059.3:c.7544C>T p.Thr2515Ile 1 ..."
 
Том 15, № 3 (2016) Исследование рецессивных форм НМСН у российских больных с использованием новой медицинской технологии «Система детекции в одной пробирке частых мутаций при рецессивных наследственных моторно-сенсорных нейропатиях» Аннотация  PDF (Rus)  похожие документы
О. А. Щагина, Т. Б. Миловидова, М. В. Булах, А. В. Поляков
"... ÷àñòî âñòðå÷àþ- ùèìèñÿ çàìåíàìè â ïîëîæåíèè 298: Met298Thr è Met298Arg (ñ.893T>C, c.893T>G) [7, 8 ..."
 
Том 15, № 7 (2016) Клинический случай спорадической спастической параплегии при новой мутации в гене SPAST Аннотация  PDF (Rus)  похожие документы
А. Ф. Ахметгалеева, И. М. Хидиятова, Е. В. Сайфуллина, Р. Ф. Идрисова, Р. В. Магжанов, Э. К. Хуснутдинова
"... ÷åñêîì àíàëèçàòîðå ABI PRISM 310 (Applied Biosystems). Àìïëèôèêàöèÿ ýêçîíîâ ïðîâî- äèëàñü ñ ..."
 
Том 14, № 5 (2015) ПРИМЕНЕНИЕ МЕТОДА МИКРОМАТРИЧНОЙ СРАВНИТЕЛЬНОЙ ГЕНОМНОЙ ГИБРИДИЗАЦИИ В ПРЕНАТАЛЬНОЙ ДИАГНОСТИКЕ Аннотация  PDF (Rus)  похожие документы
Н. А. Каретникова, А. Н. Екимов, Е. Е. Баранова, В. А. Бахарев, Д. Ю. Трофимов, А. И. Гус
"... âåäóùèõ ïðè÷èí ñìåðòè â ìèðå // Èíôîðìàöèîííûé áþëëåòåíü. — ¹310, Ìàé 2014 ã. http://www.who.int/mediacent ..."
 
Том 15, № 3 (2016) Семейная средиземноморская лихорадка: современные представления Аннотация  PDF (Rus)  похожие документы
С. А. Атоян
"... familial Mediterranean fever in various Jewish ethnic groups. Eur J Hum Genet 8, 307-310. 2000;(June 1999 ..."
 
Том 14, № 10 (2015) Ассоциации полиморфизма митохондриального генома с количественными признаками при инфаркте миокарда и сахарном диабете Аннотация  PDF (Rus)  похожие документы
Р. Р. Салахов, О. А. Макеева, В. В. Кашталап, О. Л. Барбараш, М. В. Голубенко
"... îáëàñòè D-ïåòëè ìòÄÍÊ), A10398G (çàìåíà àìèíîêèñëîòû Thr114Ala â òðåòüåé ñóáúåäèíèöå NADH-äåãèäðîãåíàçû ..."
 
Том 12, № 4 (2013) ВАРИАБЕЛЬНОСТЬ ГЕНОВ ИНТЕРЛЕЙКИНА 4 И ЕГО РЕЦЕПТОРА В ПОПУЛЯЦИЯХ КОРЕННЫХ НАРОДОВ СИБИРИ Аннотация  PDF (Rus)  похожие документы
В. А. Степанов, Е. А. Трифонова, К. В. Симонова, А. А. Чередниченко
"... çîí A>G (Gln576Arg) G rs144651842 27356224 (+) Ýê çîí G>A (Ala82Thr) A Ïðè ìå ÷à íèå. 1 Ïî çè öèÿ ..."
 
Том 14, № 11 (2015) Фолатный цикл: обзор и практические рекомендации по интерпретации генетических тестов Аннотация  PDF (Rus)  похожие документы
Н. В. Кох, А. А. Слепухина, Г. И. Лифшиц
"... . — 2000. — Vol. 70, ¹4. — P. 310—315. 11. Christensen K.E., Rohlicek C.V., Andelfinger G.U. et al. The ..."
 
Том 14, № 11 (2015) Клинико-генетические характеристики синдрома Фелан-МакДермид Аннотация  PDF (Rus)  похожие документы
Е. Л. Дадали, И. В. Канивец, И. В. Шаркова
"... different subtypes of autism spect- rum disorders // Eur. J. hum. Genet. — 2013. — Vol. 21, ¹ 3. — P. 310 ..."
 
Том 14, № 11 (2015) Триплоидия: взгляд клинициста Аннотация  PDF (Rus)  похожие документы
А. Д. Прокофьева, И. В. Василькова, Л. В. Лязина
"... . 87(4). — P. 306—310. 15. Jàrvelà I.E., Salo M.K., Sntavuori P., Salonen R.K. 46,XX/69,XXX diploid ..."
 
Том 14, № 4 (2015) МАТЕРИАЛЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И МАТЕРИАЛЫ 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... ), c.344A>G (p.Gln115Arg), c.375C>T (p.Thr125Ile), c.625C>G (p.Arg209Cys), c.892T>G (p.Phe298Val), c ..."
 
Том 16, № 2 (2017) Анализ взаимосвязи полиморфизма A/G (rs1801310) гена GSS с развитием миомы матки: пилотное исследование Аннотация  PDF (Rus)  похожие документы
О. К. Кудрявцева, Е. М. Барышева, М. В. Сорокина, О. Б. Полшведкина, Н. В. Иванова, А. В. Полоников, О. Ю. Бушуева
"... ga.bus hu e va@in box.ru, 305004 Êóðñê, óë. ×å ëþ ñêèí öåâ, ä.23, êâ.62, òåë. 8 910 310 35 09. The ..."
 
Том 13, № 11 (2014) АНАЛИЗ АЛЛЕЛЬНОГО ДИСБАЛАНСА ПРИ ГЛИОБЛАСТОМЕ: НОВЫЕ ХРОМОСОМНЫЕ УЧАСТКИ ПОТЕРИ ГЕТЕРОЗИГОТНОСТИ И НОВЫЕ ГЕНЫ-КАНДИДАТЫ Аннотация  PDF (Rus)  похожие документы
Е. А. Алексеева, А. С. Танас, Е. В. Прозоренко, А. М. Зайцев, О. Н. Кирсанова, А. Е. Самарин, Д. В. Залетаев, В. В. Стрельников
"... q21.33-AC 5,9% (1/17) DCN 500 ò.ï.í. 14q13.3-21xAC 42,3% (11/26) NKX2-8 310 ò.ï.í. 16p13.12-19xTG 9 ..."
 
Том 15, № 12 (2016) Генетические факторы в формировании интракраниальных артериальных аневризм Аннотация  PDF (Rus)  похожие документы
О. Б. Белоусова, В. А. Горожанин
"... p34.3-p36.13 Ñå âå ðî àìå ðè êàí ñêàÿ ñå ìüÿ: 22 ÷åë. / 10 ñ ÈÀ LOD = 4,2 — D1S199 — D1S496 ..."
 
Том 14, № 2 (2015) ТЕЗИСЫ VII СЪЕЗДА РОССИЙСКОГО ОБЩЕСТВА МЕДИЦИНСКИХ ГЕНЕТИКОВ, САНКТ-ПЕТЕРБУРГ, 19—23 МАЯ 2015 Г. И 3-Й ВСЕРОССИЙСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ «ГЕНЕТИКА ОПУХОЛЕЙ КРОВЕТВОРНОЙ СИСТЕМЫ», САНКТ-ПЕТЕРБУРГ, 19—20 МАЯ 2015 Г. Аннотация  PDF (Rus)  похожие документы
статья Редакционная
"... âûáîðêå ïàöèåíòîâ ñ ÁÏ òîëüêî îäèí ðàç è íå áûëè èäåíòèôèöèðîâàíû â êîíòðîëå. Äâå èç íèõ (E388K, R496H ..."
 
Том 15, № 6 (2016) Роль полиморфных вариантов гена ангиотензин-превращающего фермента (АСЕ) в формировании различных типов ремоделирования миокарда у больных хронической сердечной недостаточностью Аннотация  PDF (Rus)  похожие документы
А. Э. Пушкарева, Р. И. Хусаинова, Р. Р. Валиев, Г. П. Арутюнов, Э. К. Хуснутдинова
"... ,364 ÝêñÃñ äèë Òàòàð. (N = 34) 0,573 0,426 0,485 0,514 0,590 0,409 � 2; p 0,310; 0,578 0,203; 0,652 0 ..."
 
Том 16, № 2 (2017) Частота мутаций гена GJB2 у больных наследственной несиндромальной нейросенсорной тугоухостью в девяти популяциях Карачаево-Черкесской Республики Аннотация  PDF (Rus)  похожие документы
Н. Е. Петрина, Е. А. Близнец, Р. А. Зинченко, А. Х. Макаов, Н. В. Петрова, Т. А. Васильева, Л. В. Чудакова, А. Н. Петрин, А. В. Поляков, Е. К. Гинтер
"... .101T>C (p.Met34Thr) 6,25 (1) 0,54 (1) c.224G>A (p.Arg75Gln) 2,50 (1) 0,54 (1) Èòî ãî 47,44 (37) 25 ..."
 
Том 15, № 10 (2016) Результаты использования медицинской технологии определения наиболее частых анеуплоидий методом многолокусной количественной флуоресцентной ПЦР Аннотация  PDF (Rus)  похожие документы
В. В. Стрельников, Е. Б. Кузнецова, М. А. Иванов, В. В. Землякова, Д. В. Залетаев
"... : CTATTCATCAACTATTTCTGG 380—430 ~0,92 D18S391 F: FAM-TCACTCAGCTAATTAAATTCC R: ATTGTGAGTTGCTGTATTGAC 270—310 ~0,75 D18S ..."
 
Том 12, № 3 (2013) СВОЕОБРАЗИЕ ГЕНОФОНДА РУССКОГО И УКРАИНСКОГО НАСЕЛЕНИЯ БЕЛГОРОДСКОЙ ОБЛАСТИ (ПО ДАННЫМ О ПОЛИМОРФИЗМЕ ШЕСТИ ALU-ИНСЕРЦИЙ) Аннотация  PDF (Rus)  похожие документы
И. Н. Лепендина, И. Н. Сорокина, Н. А. Рудых, Е. В. Балановская, М. И. Чурносов
"... ,38 36,27 132,72 14,20 14,05 28,25 160,93 c 2 (HWE) 3,10 0,21 0,00 0,73 1,70 3,27 0,07 0,12 0,54 1,69 0 ..."
 
1 - 39 из 39 результатов

Советы по поиску:

  • Поиск ведется с учетом регистра (строчные и прописные буквы различаются)
  • Служебные слова (предлоги, союзы и т.п.) игнорируются
  • По умолчанию отображаются статьи, содержащие хотя бы одно слово из запроса (то есть предполагается условие OR)
  • Чтобы гарантировать, что слово содержится в статье, предварите его знаком +; например, +журнал +мембрана органелла рибосома
  • Для поиска статей, содержащих все слова из запроса, объединяйте их с помощью AND; например, клетка AND органелла
  • Исключайте слово при помощи знака - (дефис) или NOT; например. клетка -стволовая или клетка NOT стволовая
  • Для поиска точной фразы используйте кавычки; например, "бесплатные издания". Совет: используйте кавычки для поиска последовательности иероглифов; например, "中国"
  • Используйте круглые скобки для создания сложных запросов; например, архив ((журнал AND конференция) NOT диссертация)